Oryctolagus_cuniculus Locus Mono:88:SNORD77
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:88:SNORD77
Oryctolagus_cuniculus
Mono:88:SNORD77
scaffold_113884
SNORD77
1001..1068
2068
GATAGTCACAGATTAAAATTTGTATAAAGACTCCTTGCTCTGAAAATAGGTGAAGTGTG
TGTGTGTGTGTGTGTTTCTTTTATTTATTTGGGGAGGCAGATGAAAGAAAGCAAGATTAA
ACAAAGTTTCCATCTGCTGTTTCACTCTCCAAATGCTTTCAAAGGCCCCCAAATGGTACT
GTAGCTGGGAGCCAGGAACTCAATTTGGGTCTCCCACATTGGTGGTGGAAATCCAATCAC
CCAAGCCATCACTGCTATCCCCCCAGGCTCTGCATTTGCAGGAGCTAGAGCCAGGAATTG
AAACCAGGTACTCCATTGTGCATGGACATCTTGACTGGCATCTTAACCACTAGTCCAAAT
GCCCACTCCTGGAATTTCTTTTACTCTTCAATCTCTGATCCACCTGAAAATATGCCTAGG
TAGATGGGGTGAGCAACAGATCAAGTTTGCTTTCTTTTGTATTGCTGTCCTGGAGCTTCA
ATATTACTTTTTTTTAAGATTTATTTATTTATTTGAAAGTCAGAGTTACACAGAGAGAGG
AGAAGCAGAGAGAGAGAGAGAGAGAGAGAGGTCTTCCATCTGATGGCTCACTCCCCAATT
GACTGCAACAGCTGGAGCTGCGCTGATCCGAAGCCAGGAGCCAGGAGCTTCCTCCTGGTC
TCCCAAGTGGGTGCAGGGGCCCAAGGACCTGGGCTATCTTCCACTGCTTTCCCATGCCAT
AGCAGAGAGCTGGATTGGAAGTAGAGCAGCTGGGTCTCAAACTGGCACCCATATGGGTTG
CTGGCACTTCAAGCCAGGGTGTTAACTTGCTGTGCCACAGCACCAGCCCCTCAATATTAC
TATTATAAAAGTCCACCTCCTTGTCCCCTCTGCAACTGTTTTGATATGTCATATTTATCA
TATACAACATTTACTTATTTTGTGACTATTTTGTTCTGGCCCACTGATCCATGCACCTAA
TTGTATATCAATGTCCCATTTATTTAATGAAACAAACATGAACACTATAATGGTTGCATA
GTTCATCAGATTGAATTCTGAAGAGATATATCATTGCTCTGATGTATCTGGGGATAAAAA
AGAATCATGATAATATATTTTGGTTTAGGGTAGGATTTACTCTACTGTCAACATTTCTAT
TTTTTCAGGGTTTCTCTTGGTATTCTTACTTGTGGCTTTCACTAAATGAAATCAAAATAT
AGCTTCAAAAATGCTTGATGGTATTTTTATTGGAATCACTAAATTGAGATGACTTAATGA
ACTTTAACATATTTATCATGTCAATTTTCCTTTTAAAGATCACAGCATTCCACTGTTGCC
AAAGATATCAGAAATCACCACTAGAAAATATCTACTTTTTTTTTTAAGTTTTACAATATG
CTTTGGGCCATCTATATATAGGAAGAAGACTGGAGAGAGAATATTTCCCAATATTCTCTT
CACATAGGGCCAAGGAAGATTACAGATGAAGAATATTCCAGAGTTGGAGCCAAGCATACA
GATAAATGGGCAGAAGAGCAGAAGGACCTAAAAAAGGAGCATTCTCCACCCCTCAGGCAG
CTCTGCCCTATTTCAGAAATTCTGTGTACCAGTGACTGTTATGCACATTTAATGACTTCC
TGGTCTTTCACAATGGGAGTGTTTGCTGCTATTAGTCTTTGCTGTCCCAACAGTTTAGGT
TTGGGTATTTAGTTCATAGGTCTTTAGAATAATCCAATGCTAGCTGACCATGATATAAAG
ACTCTTACATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCATG
AGGGGAGAGAATGACTTGACATTTGGTAATGAACAAAGGGGAATTCTGCATGGACTTTTG
GGCCACTTATTTTCCTCTGTTTCTAAAAGGATGGGGGTTATGATTTTTTTTCATCTTTTG
TAGTTAAATGAAATTGCTTGTTACCATGGCATATGTATGTATTTTCACTAATACATGGGG
ACTGCACATTTTCATGTATGTGGTGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved