Oryctolagus_cuniculus Locus Mono:214:SNORA24
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:214:SNORA24
Oryctolagus_cuniculus
Mono:214:SNORA24
GeneScaffold_5753
SNORA24
1001..1131
2131
AAATCATTTGGTGACGGTGCAGTACTGTCAATACACCAAAGAGAGTAGACCAAAACCAC
AGGAAAACAAAAGCAGAGCCGCCGGAAACGCCGGCCCTTCGGGAGCAGCAATTCGAGCAG
GAGGGGAAAAGAAAAAAAAAAAAAAAACTACTTCTGTATAAATGAACCTACTAAAAGGCT
AAGAAGACAACCGTTTCGGTAATAAAGTGACTTCTGCCATAACTATTCTACACAAGAAAC
CACACAACTATCATCCTTTTCAGTCAGCAGGCAACCAAGAGCGTTAAGATCTCGCCGTCC
CGCGATAACTTCACGGCGCTCACCTTATGCGCATGCGCCTGAAGTCGGCGCTCGGAAACT
GGCTCAGACAATGACGACGGTAAGGGCAGAAAGAAGCCGAGAGAAGGGAGGGGCCACCAG
GAAGGTGGTGGCCAATGGGAATGGTGGAGCCGAGGCGGACTGGGAGGGGTGGAGCGGAAG
GGGAGGGCGTTGGGTCCCGCTCTTCCTTTCGCGTCCCCAGGAATACGTCATCAGCTCTAT
AAGAGGGCGTGAGCGCAACAACGCGGCCTTTTGCAGCCGGGAGCGGACGCGGTGGGTGCA
AGTCAGCGTTTGTCTTGTGCGCTAAAATGATAGTTGGGACAGAACTTTTTCGCTTAATCA
AAATGCAGGAATTCCAAGAGTCTCGTTATAGTGGTAGGTCAGGATCATTTTTGAAAACTT
TGAGGCAGGCGAGCCCGAGCGGACTGAGGCGCTCGTTAGATGGCGGGGTGACCACGTGGA
GCCCTGGAGTCTGAGCCCCAGCCAGCGCGGGCCGGGCGCCCTCGGAGATAGATTCGGCGC
ACCTGTTGACTGCGTGAAGGGCTGTTAGCTGCTCTGTCGGCGAGTCTAGTCTCGCTACGA
ATTAGTTCCAGAGCCCTCTGAGACCCGTCGCAGCGAGACCTAGCTGGTGAGTACCATCTC
TAGTAGAAGTTGTGCTTGGTAATCGGCTCTGGACTGTGGATCTCCATGTGTCTTTGGGAC
CTGTCAGCCGTGGCAGTCTCCCTTCCTAGCCATGGAAGAGCATATTCTTGTTTATTGGCA
AAGCTGTCACCATTTAATTGGTATCAGATTCTGACTTGCACAAGTAACATTCTTAAATGA
AGAGATTTGGAAGGGTGCCTTGTTATTGGGTACACTTTTCTAAACTTGTTCAAAATCTTT
CTAGGAACTTGAACTAGATTGTTCGATGGGTGATGAAGAACGTTAAAAAAGGTACGTTTC
CACATACCCATATTTCTAGCTTAATCGGACTCTTGCCTCTGAGATATCAGCAATAGCCTC
TGAATAGAAATTGGGATTAGCTGCTAAGGTGTCAGGACAGTGAGGGAAGGATGGAGACCT
GAGTTTTACATTACTGGTTTTCTTTTGCAGATGCCAAGAAGTCCAAAGAGATAAAGGTGA
ATAATGGCAGCGTCCTGCAGTGGATCACCAAACTTATTGCTGGACAGAATGAGTGTTTAG
AATGGTGGTTTTTGTTCATTTTCTATTTTAGAAACTGGTACTGTGTTTTCAATGTAGCAC
CTCAATTTGAAGGTGCTTCTTTGATGCAATGAAATAAAATGCTTAATTTTTGTAGGTAAT
CAGTGTTGCTTGACTGAATTGTAGGTGGGAAAGAAATTTAAAAATAGTAATCGGTACCTT
CTGCTTGTGGTTTAGCAGAGGTTATTACAGCACTAGGAAAAAAGTAATGTATGTAAAACT
ACCAAGTTACCCCCAAGAGAGCAGTTTTCCTATGCCAGGCAAAAGATACTGCGACCACAC
AAGGTAGAAAGTAATACTTTATTACACAAATATGCACTGAAAACTTGGACTTAAAGATCC
AAGTCATACTTGAGACCAACATGGTTATAATAAAGGCATGTTTTATGAACGTTGTGATAG
CTCAGGATTGAGTGAATTGCAGGTTGCTTGTTTGCTGCCCTTTTTTTGGTGTGCAAATCC
CTGATCTATTTAGAATTTCCACAGAAGTGTATGTCACACCATGACTAGTTAGAAGGGCAG
ACAGAAACTTAAGGTGAAAGTAATGGTTTCACCTATATTGCACATTCCCCAAGCCCTTGA
TATAAGTGCATTGTACACAAATGTAGCTTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved