Oryctolagus_cuniculus Locus Poly:17:SNORD99
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:17:SNORD99
Oryctolagus_cuniculus
Poly:17:SNORD99
scaffold_124534
SNORA44, SNORA61, SNORD99
1001..1131, 1287..1415, 1865..1944
2161
AACATCTATCCAGGGGCGATTCTTTGGATCGCTGCCTCAACACTAGGGCATCAGGGTAA
GGACCAAAACTGGACAGGCCAGGAAAAGGGAGCAGGTGGACAGCTGTGTTCTCATCGTAG
GTGTGCCACGTGATGCTGGCAGACGTGGGGCGGTGAGGACCCCGGCGGCATCCTCGGGCT
GGTAGGTTTCTTGTTTGGGGCTGCTTGCCGGGACAGAACAGCATGTTTCCAAGGGCTGTG
GCTGGCTGTGGCCATGGGATCTCCAACTGCATGCGAGAGCAACCTGGAGAGACTTTGACA
GCTCAGGTCAGCACCGTACCTGCAGCTGCCACTCAACTTTCCGATAATTTCAGGACCTGC
CTGGGGGTGGGGGTTCGTCCTAGTCGGAAGCCCTCACTCAGCTTTTTGTTCTGCAGCCTG
ACCGGGTTTCTGAAGAGCCCAGCTTGCTGGCTTCTGGAGCAGTGCCTTTTTTAGACTAAG
GTAAACTTAATGAAGACAATCTGAACCCTCCGGTTCCCTTTCCCATCGGATCAGAACACT
GGTCTTGGTGGTCGTACAAGGAGGAAAAGTGATACTGAAGCTGGCCTCACCGTGTTGTAG
TCTGATATAGCACTGGGCCAGCGTCAGACAGGGCTGACTTCCTCCTCCCTTGTGGTCTTC
AGGGCGAGGGAGGGATTTACTGGAGGCTTGTTCTTTTCTTTAGGTCTACGCTACAGAGGA
TCTGCAGGGCTGGATGACTACTGAAGGGACACGAAGTCTGCATAGCTCCACGCAGTGGCC
AAACTGCAGCCATCACTCAGGTACATGTGAAAGGCTTAGCCCTTTAATAAATAGAGCGTC
TTGTGCTTACTTAGCTGAGGGCAAAGAAGTGCCTGTCGTTTGGCCAGGTCTGTTAGATCT
GCCCACCCTGAAGGCCATGATCAGGACTGCTCTAAGTAGAATGAAGCAGGGGGAATGGCC
CTATACATTGCAAATACACGATGTTGGTTGGATGCATGCTTTGGTAGGACCTCGTCTCCC
TCAGCGAAGAGTGGGCAATAGAGGGCAGAAGTCATTTAGCCTAGTTCACATTCTTTAGAC
TGACTGGTCCAGGATGAATCCTAATCTGAGTGGACATCTTTGGATGAGAAATGCGGATAT
GGGACTGAGACCAGCTCTTGGGAAGGTGTCTGGTTAGGGTTAAACAGAGCAGGGCTAACA
CTGGCCTATACTTCTGTTTCAGGAAAACCAACAGAGGGATGAAGTAGGCTGGCATGCAGC
CTAAAATTGATGAGGTTTGTGAACCAGAAGACCACGCCTTCGCCATACCCGTGGGACCTC
ATGCCCCTACCTGGCCACACCTGTGTGCCCATCACCAGTCAAGTTAATTAACCACCTTTG
GAAGTGGGTTAAAAGCTTGGGTGTGTCTGTCCTGCCCTGTTTCCTAGCCTCTTGCCAGGA
GGGGGCTGTGCCACCCACCCTAGGCTCCCTGGTGCTCTGTATGAACCCCTCTCTCAAATC
CTATGCATCTTTTGCACTAAATAAATGCCTAAAATGTACCACACTGCCTCATTTATTTAT
GCTGGTATTTAGGATTCTCTAAATATTAGGCAAGAACCCTCAGGCTTATTGTTGGGGGTT
TATTAATAATAAGCATATGGTGATAATATATGGCACTCCAGCTGAATTAAGGTAAAACTA
TGGTACATTAAAAGCTTTATACATGTTTGTGAACTGCCTGCCTACCTTACCTGTTGATTC
TTGGAAATCAGAATTTAATCAGAGGCCAGCACTGTGGGTTTGGTATTCTCATGTGGGAAC
CAGTCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved