Oryctolagus_cuniculus Locus Mono:73:SNORA77
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:73:SNORA77
Oryctolagus_cuniculus
Mono:73:SNORA77
scaffold_209878
SNORA77
1001..1122
2122
TTTTATTTATCCTATAATCTCTACCATTGAGAGATGTTCCTTTACTTTATAATTTCTAA
AAGAGTCCTTTTTAAAAATGAGGAGACAGACCTGCAGAACCCAAATAACAAGCTCGCAGT
CACATGATACATAACAACAGAGTGACACATGGACAGAACTTCTGGGTTTAAAACCACAGT
GCTCCATGGGTGTGTTCCATATACATTTTAAAATTAGTAGCAAAGGGCATTAATCCTCAG
CTTTAACTTTCCTTCAGTCACAAAATGTTCTTTTAGCTCCCGGCATGAAGATATTAAAAA
CAAGGACTCTGGCTTTGGTTCAGTTGCTAAAAGCATGTGCCGTCAGGAGCTGTTAGATTT
TCGTTAGACTTTTGAGAAGTATACATCAGTCTTAGGAAAGCAAGGGCATTCTTTCCATTT
ATTTTGTATTCTCTCTTCCATCAACAGAAAGAGAAATGAAACAAAATAACATGGAAAGAA
CAAGAGACAGAGGTTGTGAATTCAATGTTCAGATGGGTACACTTATTATATACCAATTCT
GTAGTAGAATGTGTGTTTTATGTGTGTTATTTTGTTGTAACCCTCTGAAATAACATTGTC
ATTCACAAGTTATAAAATAAGAAATTTCTCAAAACTGTTTGGAGGTTTCCCCTCTCACTC
AGGACCGTGCCATGTTTCTCACCATGCCTGGTGAGACCCTCCACAGCTACTTGGATAGTC
ACATATTGAGGGTATAAAACCCAACATTAGAAGCAAGATTTCCACCTGTTACCTCTGCAC
TACTGCAGACACTGGGAATGGCACCAAAATATTATATTGTTCTTCTGCCCAATGTGAGGA
AACCTTTTTCGGGTCAGGCTCCAGCCAGGTGATACTATAATCCAGCTCAGATTTTTCCAC
TGCCTGACAATGTTTGAGATATCCCAAATAAGAAGCGGCTTTCACATTGCATAGAGTACA
CAGTAGACAAAGGAGCTGCATTGCAGGGCTGTGTCCCTTTTACAGACTCACCTTGCACCC
AGCCTGTCCCAGGCGGGTGCTTTTTTCATCTGCCAGAGAAACTTTTCGGGGTACTGTGGC
CACTTTGACCTCTCGGGTGATGCAGCTACCTGAGGGCACAGGGTGCCTACAAAAAGTTTC
TCTCAATATGCATGTGTTGGGGACAGTGTTGTAGTATAGCATGTATAGTCACCTCCTACA
ATGCTGGTATCCTATATAGCTGCTCACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGATCTGATTTCATCATCATT
TAAAAAAAATCATCTATTATTTTTCACTTTATGTTTCTGTGTGGGAGCAAACTGTTGAAA
TACTTACTTAAGGTATACTAAGCTGATCTTCTGTATATTAAGATAATCGAAAATGAATCT
TGATGTGAATGGAAGGGGAGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved