Oryctolagus_cuniculus Locus Mono:186:SNORD61
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:186:SNORD61
Oryctolagus_cuniculus
Mono:186:SNORD61
GeneScaffold_3282
SNORD61
1001..1072
2072
TTTAAATCCTTTCAAAACTGCAAGGATAAACCCAACTTAATAGCTTAATAGCTAAAGTT
TGAGTAGTTACTATTACCAGAGGCTAGCCAAATATGGTATATGTATTAATTCCCAATAAC
ATCTATGATATTTAGGTAATATTAATTAATACTATTAATTAATATTAGTTAGTTAGTGTG
TCTAAAAAGGGAAACCAAGGTTTGGATGAAGTATCCCATCCAGGGTCACGGCTCATAATT
GGCATAGCCAGAATTCAGACCCAAGCCAGCCTCACTGCAGAGCCTGTCTCTTATCTACTA
AGCTTTGTTGTTTATATGATGATTGAATGTGAATTATCAGCTGTAACTCAGTAAGAAGGT
TTTTGAATCACTGTCAACTGGAAACATGAGCTCAATGTGTGGCTATATTTAATGATATTT
TAAAAGAAAAGGAACCCTGCTCTTACCTTTAAAAACTTTGCCTATCTATACCTGAAAAAC
ATGATCGATGGTGACCTCCAGAAAATATATAAAGGTAGGAGAGACAAAGACTTAATACCT
AAAATGGCCAGAGGGGTAAAGTGGACTTCTTCAGGGAAACAGACCTGAATGGCAGAACAG
AATGACGCAAGGCTTTTCCGCTACAGCTTACTAGAATCAGAGGGCAGGCATGCAAACTTG
GAGGTGGTCTCCAAACAAATTCTAAGTACTGCTTTAAGGGCCAGTGTTTGGTGCAGCAGT
TAATACTGTCTAGGATGCTCTCACCCCACATGGGAGTGCCTGGTTTGTGTCCTGGCTGCT
CTGCTAATGCACACTCTGGGAGGCAGCAGGTGACGGCTCAAGTCCTCAGGTCCCTGCTAT
TCATGTGGGAAACCTGGATGGAGTTCTTGGCTCCCAGCTTCAGCCCTGGCTGTTGTGTGG
GCATTTGGGGCAATGAACCAACTGATGGACAGTTTCTGTCTCTGTCTGCTTTTCAAATAA
ATTAAAATATATTCTTTAAACCTTTAAAAGTACTTTACAGAGCTATGATGAATTTGATTG
CATTGATCATCAGACATGATAATGTATTTTGTCCTCTAAGAAGTTCTGAGCTTTAAAATA
ATAATAATAATAAAGTACAAAGCCACTGGAGACTACATGGAGGGAGGTACAGCAGAAAGA
CCACTGCCTCACACATAAGATGACCACTGGAGTTGACAAATGGCTCCTTGCTGCCTAGCA
AGATGCTTAGCCTCTCTGAGCTTAAGAGTTGTAAATGAGAACATGTGTGGCTGTTATTTG
CATATTCAGCTTCTCATCCCTATCCTATATTTAAAGGATTCTTGTCCTTGCTGTGACTCC
TTCTCAACAGTAAAAAATTCCTCTAAAAGTTATTACCAAAGGATCGTGTTTTCAAATAAA
TTTTCCTAGTTACACCTGGAGCTTTATTACCATGGAAGTATTTAAGTTCTAACATTTATT
CGAAAGGCATAGAATGACGAAGATCTTCCATCTGCTGGTTCACTCCCCAAATGCCTGCAA
TAGCAGAGGCTGGGCAAAGCCAGGAGCCAGGAATGCCATCCAGGTCTCCCACATGGGCAT
GAGTGGCAAGAACCTAAGTCCCTGAGCCTTCATCTACCTCCCAGGTGCATTAGCAGGAAG
CTGGACTAGAAGTGGAGCCCAGGCACTCCAATACAGGATGTGGGCATCCCAGGCAGCAGT
GGCTTAATCTACTGCACCATAATACCTGCCCTTCAAACATTTCACTGACAAATTATATGG
CATCTAAATTCTTTTTTAAAAAGATTTATTTTATTTGAAAAGAGTCAGAAAGGGAAGTCT
TCCATCTGTTGGTTCATTCCCCAAATGTCCGCGATGGCTGGAACTGAGCTGATCCAAAGT
CAGGAGCTTCTTCTGAGTCCCCCATGTAGGTACAGGGGCCCAAGCACTCAGGCCATCTTT
TACTGCTTTCACAGGCCATAGCAGAGAGCAGGATTGAAAGAGGAGCAGGTGGTACCAAAT
GGATACTGGTGCAGCAGGCTAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved