Oryctolagus_cuniculus Locus Mono:233:SNORA42
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:233:SNORA42
Oryctolagus_cuniculus
Mono:233:SNORA42
GeneScaffold_1933
SNORA42
1001..1133
2133
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCAGCCGCTGCGCTCGCGGGGACCGCGCGGCGGCCGGCGGTAGAGTGCAGG
GCGGCGCCGCCGGCCCCGGCCGCGGCCCCGCGATCTGGAGGACCGGGGCTCCTTCTTTTC
CGGCTTTCTGGCTGCGGGGACGGGTGACGCCGTGGCAGAAGCGCCCGGAGTCGCCGGAGA
CGGCTGGTGCGGGACTTGGAATGGTTTATTATCCGAGGGCTCTCTGAGCGACTTGGCTCA
GGCCAACAGGCGCGCGTAGGAGCCAGCCTGAAAGTTTTTTTTTTTTAAATAAGGCTGATC
GTGTAGTTCGAGAATTCTGAGTAGTGGGTGGCAGCGTGGGGACGGGATGTGTGGCTCGCT
TTCTTCAAGCCTCGAAGTGGACGGAGTCTACTGGACTCGGAGTCGCCGTGTGGACACGGG
ACCGGCTGGTGCCGGTGCGTGGACCGTTTAGCGCAGCGGCTGTTCCGGAAGGTCGCTGCG
TAAGGCAGAGTTACTCTGGGACATCTCAAGCAAAGCTGTGAAAGGATCTCGGAAAGCAAG
ATCCTAAACGGATTGTATTTCAGAAGAAACGAATGCTCTTTTAGTAACGCCTTTAAGTAA
AGCCCTTTAAGTAACGCAGCTCCTTTGGGGAGTTCGGTTGTCACCGATACTGTGTAGCCA
AAGTGGGTTTCCTGGCCGTGGCCTCTTCCCCGCCCCAGGGTGATTGAGGTCGACAATGCC
AGGAACTCAATTAAAGGGAGGCCGGAAGCCTGTTGTGCCACGCATGGGTTTGGATTGATG
GCAGGTCCGTCCCCCTGGGCCTCTCATAGTGTCCCATGCCACAGCAAACGGTGGCCCCGA
ACCATTGCCGGCCTCTGTCCGTGGGTTGTTGGCACTGAAGCGGGTCGCACAGTAGGAAGA
AGCCTCCTACCTGGCACAAGTCATGCAGGGTTCAAGTCAGGCCTTGAGGGGAACTCGATC
ACTGGTGTCGCGTTTCATGGAGTCCAAGGACAGTGGCTTTTATTGTTAGCAGCCTGACGT
TCCGGCTTATTTTTATTATTCATAAAGTTTGCCCGCGTGATTACTCACGCTAAGCGAAAC
AAGAGTATTCCTAGGGGCGGCTGGGCTTCCCGGCATGGCTAACGGGAGGCAGCATCGGTT
GGGGAACGCCGATTTCCAACCAGATAGCGGCAGCTGGAAGGCTGCTTGGCGCGTGAACAC
GAGCCGACAGGCGCTCGTGGTCGCGTGCCCTGGGTACTCCCGCGGTGCTGCGCTCTGTGA
GGCGTGGGGAGGGTGGGAGTGCTGGCTGTGTCTGCGGTGCTGCCTGACGGTCTGGCAGGT
GTGCTGCTTGGGGAAAGCCCGGTGTGGAGTCTGCCGTCCTGTTCTGGCCAGGGACCGGCA
GCTGTGACGTGAGCCGGGAGGAGCTGGGATGCCGGTGGCAGCGAGGGGGCTGTCGGCTCT
GGTGCCGGTGAGCGCTGCCTCCTGCGTGTGCCGTAAGGTGAACAGCGTCCCCTGTGTGCT
CTGTCCCTCAGGTCCTGTGCACACTGCTCTGCGGGCACACAGGACCCGGACCCTGGAGGA
GTGCCTCTGTGGGAAGCTGCAAGCAATTTCTCTGAGTTTCATCTCTTGGTTTTCCATGTG
AGCGTTCAGATCCGTCTGCTGGAGGTGGGGTCGGGGCAGGCACTGCCGGGGTCTCTAAGG
GCTCCCCTCCCGCTGCAGAGGGACATCGAGGAGCCATGAACAGCTCGAGTCATGAAGAGT
TCGACTGCCACTTCCTCGACGAAGGCTTCACTGCCAGGGACATCCTGGAGCAGAAGATCA
ACGAAGTGTCGGCGTCTGTGAGTGTGCGGCCTGTCCTCGTGGGCGCTGGGGCCGGCCCAG
CGGACGCGCCGGAGGGCTCCGCGGGTGGGGTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved