Oryctolagus_cuniculus Locus Poly:13:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:13:SNORD116
Oryctolagus_cuniculus
Poly:13:SNORD116
scaffold_104068
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1094, 3657..3750, 6386..6479, 9061..9154, 11715..11808
12808
TGTTTCCGGCCGCAACACAGAAATCCTGGGCAGCTATTGAGGAGGTACCCTGATTGTAT
TCATGACTGAGGACTGTGCAGGGCACCCCACACCTGGCAGAGGTTCTAGGCGACCAAAGG
CCTGACTGTGTCTCAGGTCCTATGAGGGAGTATGCCTTGCACAGCGGTTCTTTCTTTCCC
TGTTAGCTGCCACAAGTGTGTGGGGTTCCTGTGGACCTTGTCACTCTGGGCCAGATGTCG
GTGCCCATCATGATATTGAAGGCTCAGACACCAGCAAAGCAGTGCCGGCAGGTAGATGCC
AAAACTCTTCAGGCAAAGGTCATCGATGGCAGGACCAATACACACTAGGGACATGGACAC
ATATGTAGCGTAACTCGCAACTTCCCAGAATTCAGAACTCAAGCTGAGAACCCACAGCAG
CACACTCAAGAGAAACTTGTATAACCAGAGTTCATCATGGACAGACTGGCTTGTGTGTAA
GGAAGCTTCAGGGATGAAGATTGAGGGGATGTGCTGTGGCGCAGAGACCAGGGGCGTCCT
AAGCATTGCAGGTCAGAGAAGGCCATGGCTCTGTTTTTCTCAAGCGTGCCTGTGGTTTGT
GTGTACTTCTCAGGACCGCTTGCTGATGTCAACATGGCCATGTAGGGCAGCAAGAAGTGT
GCTTCTGCTGAGGACTTGAGGACCTATATGATGGTAGAATTCAAATTGCCCTTGGTGAGT
GGGAAGTTCCTGGATCTCTGAGGACGGTAAGCATGGCCAAGGCTAGATATGGGCACAAAG
GCAAGCACTTCACACACCAGCAGGCTTTTTATGCTCACTGGAGTCTTTGGGGTCTCCCTG
GCCACACCTCTGCAGTGGACCGCACCACTGCAGTGGACCGTCTGTCCTCCTTGCACTGGA
GGATATCCCTGGACTCTGCGGGGTGCGAAGGTGGTTGGGCGGAGCAGCTGATGAAGCAAC
AGGCCTTTGGGGTTGAGGGCCCTACACCTTGGCATGTGCTTGGATCAATGATGACTCCCC
CATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCA
TCGTGAGTGAGGTCCAGCACATTGCCTCTGGCAGGGACTATGGCAGTGAGGGCCCACGAT
TGGGGTAGCAGTTCTCTCCACAACCCAGGGTGTGCCTAAGTTGAAAGGTCCATTTGTGTG
GCTCAGGAAGGCAATCACTCAGTTGTCCATATGGGCAGCAGAGTGCCTTGTGCAATGGTG
CTGTGAGTTTGCTTGGCAGCTATCCATGTGGGAAGCAGTGGTGAAGGATGTAGCAGGGTG
TACAGGGTCTGATTGTGTGGATGTGCCCAGGCCACTTGTTTCCCACGAGGGTCTCATGCA
TGTGGCAAAGTCCTTGGTCCCTGTGGGGTAGGTCTCAGAATCAAGTCTTTTCGTCTTGGC
CAATTGGACCCACGAAGCCCGGTCCCCCGTCTAGCTTTAGGTCTATGAGCTGGTGGTCTG
ATGTGGCAGCAGAGTTCTGCAATGGTCTCAAGAGATCAGGCATCCCCTTTAGTATGGCAT
TGACACTTGGTGGTAGTGCCTGATGACCTGGTGGTAGGAGTCAACCTGGCATGAATGTTG
TGTTCCCTTCTCTTGGGAGAGTCTTCCACAGAGTAGAGTGGCTCTTGGGCTGGGTGCAAA
GGAAATGACAGGGACAATGGGATGGGTTGTCTCTGAGGAAACCCTGGTGAGCATGGTTGC
TGTGAGTTCTCGTGACCCCAGGTAGAAGGTTAATCCTTGGAGCTCCCAAGGTGATTCCTG
GTGATGTCAGAGTTGGTCATGCAGTAGAGTTTGGGCACACAACAAGTACAATTTTTTTGG
TGCCTTGTTGGGATCTAGGCAAGTAATGTGCCTGGATCCCTTTGCTGAGGTTGTGAGTGC
CATGTAATCTGTTGTACTCTTGCCCATGGATGAAGTAGGTTTGGAGGACTGTGCCACGAA
TCCTGGGTACTGTGCTTCTCCTATTTGAAATGGACGAAACCCCCTTTACCTGGACTTCAG
AGGCAGAACCAGTGAAGTGACACAGTTAACTCAGGAGAGTTAGGACCTTGGGCATGGTAG
CTTCCCTCAGCTAGTAACAACAGCTGTTGGACACTTCAGGGCCTATAACTCATGCCCCTG
GCTCCTGTGCCTATATTCCTGGAGCCCGAGCCCAGATTGTCTTGGCCAGCAGAGAAACCT
CAATGTCTTGTGGGTGGGAGGATGTTTTTAGAGGCATTTGCTGTACTCTGAGGTTCTGAC
TAATCTTTTGTCTGAACATACCCTGTCTTGGGGGATTGGGTCATGCGGCAGGAATATTAT
CCTGGTGGTTTTCCCTGGTCCAGTCGCTGCTCATTTGTGCCACTCCAGTATTGCACAGAC
CTTTGGTTTATCAGGTGTGAGGTTTATCTCAGTGGTTTGAGGGCTGGTTGCATGTTCCCC
TGTGCTGACTTCAGGACATTTGGTGGGCTTGCCAGGGTCGGGGCGATTACGGAGAGGCAA
TTAGGGAGAGGTCACTGGGGTCAAGTCTGACCCTGGGTGCATCTGGGCAAAGCCACTGCT
AGCCCCCTAGACCTGCGAGACCACAACACACAAATGAGATTGGGAGATGCAGGAGCGGAA
GTTCTCGGTTGGCTGTGTTTGCAGTGGGTCTCCAGCCCTTTCTGGCCACAACAGAGAACC
CATGGGCAGTTGTTGAGGAGGTGTAGTGTTCGTACTCATGACTGGGGACTGTGCAGGGCA
CCCCACACCTGGCAGAGTTTCTAGCCGTGGAAATGCATGACTCTATCTCAGGTCCCGGGG
GACAGCATGCATCACACAAGCGGTCCTTTCTTCCCTGGACGTTGCCACGGGTTTTCGGGG
TGCCCATGGTCCATGTCAGTGTGGACCAGATGTCAGTGCCTACCCATGGTATTGAAGGCT
GAGACCCCGAGCAAAGCAGTGCCTGCTGGTAGATACAAAAACTGTCCTTTTAAAGAACAC
TAGTGGCAGGTCCAACACTCACTTGTGACACAAATGCACATATACCGTGACTCACATCTT
CCCTGAATTCCAAACTCAAGCTTAGAATTCACAAGAGCCTACTCACGAGAAACTTGTGTA
TGCATAGTGCTATCATGGAGACAGGCTCGAGTGAAAGGACGCTCAGGGATAAAGATTGAG
GGGACGCACTATGGCGGGTGATACCACAGCAGCCTAGCGTGGCGGCACAGAGCAGGCCAG
GGTTCTGGTTTTCTCAAGCGTGCCTGTGGTTTGTGTGTACCTCTCAGGACAGGTTGCTGA
TGTCGACGTGGCCGTGCAGGGTGGGAAGAAGTATGCTTCTGCTGAGGACTTGAGAACCTA
GAGGATGCTAGAATTCAAACTACCCTTGGTGAGCGGGAAGCTCCTGGATCTCTGAGGATG
GTAAGCATGGCCCAGGCCAGCACTAGGCAAAAAGCCATATCACTTGACAGCCCCACAGAC
ACCTGAATGCTCGCTGGAGACTTTGGCCACGCCTGGGCCACACATCTGCAGTGGTCACCT
TCCTCCCTGCACTGGGGCACATCCCTGGACACTGTGCGGTGAAAAGATGGTTAGACTAAG
CAGCTGACGAAGCACCAGGCCTTCAGTGTTGAGGGCCCTACACCTTGGCATGTGCTTGGA
TCGATGATGACTCCCCCATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTC
ACAACCGTCGTTCTCATCGTGACTGAGGTCCAGCACATTGCCTCTGGTAGGGACTATGGC
AGTGAGGGCCCACATCCAGGGTAGCGGTTCTCTCCACAACCCCAGGGGGTGCCCATGGTG
AATGGTCCATTCGAGCAGCCCCAGGGGACGATCCCTCAGTTATCTGTTCAAAGCAGAAGA
TTGCCTGGTGCAGTGGTGCTGGGAGTTTGCGTGGCGGCTCCCCACATGGGCAGCAGTGGT
GAAGGATGCAACAGGGTGTGCAGGATCCAATTGTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGCTGGGTGTGGCCAAGGCCCTGTCTTGTACCATGGAGTGGTTCT
CTGAACCGAGTGCTCCTCTTCCTTATCAAAGGGAGACACAAAGCCTGGTCGCCTGGCTAG
CATTAGATGTCTCAGCTGGTGGTCTGATGTGGCAGCAGAGTTCTGCAATGGTCTGAAGAG
ATCAGACATCCCCTTGAGTGTGGCATTGACACTTGGCAGTAGTGCCTGTGTGAGCTGGTG
GTAGGAGTCAACCTGGCATGAATGTTGTGTTCCCTTCTCTTGGGAGAGTCTTCCACAGAG
TAGAGTGTCTCTTGGGCTGGGTGCAAAGGAAATGACAGGGACAATGGGATGGGTTGTCTC
CGAGGACACCCTGGTGAGCATGATTGCTGTGAGTTCTCGTGGCCGGGAAGAAGGTTAATC
CTTGGAGCTCCCAGGGTGATTCCCAGTGATGTCACAGTTTGATCATGCAGTAGAGTTTGG
GCACACGACAAGTACAATTTTTTTGGTGCCTTGTTGGGATCTAGGCAAGTAATTTGCCGG
GATCCCTTGGCTGAGGGTTTAAGTGCCACGAAATCTTTTGTACTCTTGAACTTGAATGAA
GAATGTTTACAGGACTCTGCTACAAAGGCTTGGGTACTGTGCTGATCCTTTTGAAATGGA
CATCTCTCTTAACCTGTGCTTCCAATGCAGGAACAGTGATGTGACACAGTTATTTCAGGA
GAGTTAGGACCTTGGGCATGGTGGCTTCCCTCAGATTGCAACAGCAGCTGCTGGACTCCT
CAGGCCCTGTAACTCATGCCCCTAGCTCCTGTGCCTGTAATCCTGGAGCCCGAGCCCAGA
TTGTCTTGGCCAGCAGAGATAGCTCGATGTCTTGTGGATGGGAGGATGTTTTTAGAGGCA
TTTGCTGTACCAGAGGGTTCTGAGACTAATCTGCTGCCTGACTGCACCCTGACTTGGGGG
ATTGGGTCATGTGGCAGGGACATAATCTTGGTGGGTTTCCCTGCTCTGGTGGGTACTCAC
TTGTGCTAGATGTGGGTAGCGAAGTCCTCTGGTTTGGCAGGTGTAAGGTTGAATTAAGCT
TCAATGGGTTTGTGGCCTGGTAGCCTGTTCCACTGAGCTGACTTCAGGACATTCGGAGGA
CTTGGCAGAGTTGGAGCTATTAGGGAGAGGCAATTAGGGAGAGGTCACTGGGGGTCAAGT
TTGACCCTGGGTGCATCGGGGCAAAGCCCCTGCTGGCTGCCCAGGCCTGGGAGACCACTG
ACACACAAATGAGATTGGAAGATGCAGGAGCGGAAGTTCTAGGTTGGCTGTGTTTGCAGT
GAGTCTCTTGCTCTTTGCTGCCGCAACACAGAAACCGGAGCAGCTGTGGAGGAGCTCCTG
TGATCATACTCACTTGGTGACTCTCAGAGCACCCCACACCTGGCAGAGGTTCTAGGCGAC
CAAAGGCCAGACTGTGTCTCAGGTCCTATGAGGCAGTGTGCCTCACAAAGTGGTCCTTTC
TTTCCCTGGAAGTTGCCACGGGTTTTGGGGTGCGCGTGGAAATTTTCACTCTGTGCCAAA
TGTCAGTGCCCATCCACGGTATTAAAGGCTCAGACCCCCAGCAAAGCAGTGCCGGCAGGT
AGATGTCAAACCTGTCCAGAAAATGGTCACCGACGGCAGGACCAACACATACGAGGGACA
CGGACACATATATACCGTCACTCACATCTTCCCAGAATTTAGAACTCAAGCTGATAACCC
ACAAAGGCCTACTCAGGAGAAACTTATGTGCCCATAGTTCCATCATGGACAGACTGGCTT
GTGTGTAAGGAAGCTTCAGGGATGAAGATTGAGGGGGGGCGCGGTGGCAGGGGTCACCAC
AGGCAGCCTAACCCTGGCTCGGCCGGGGCTCTTGTTTTATCAAGTGTCCCTGTGGTTTTG
TGTGTACTTCTCAGGACCGCTTGCTGATGTCAACGTGGCCGTGCAGGGTGGGAAGAAGTG
TGCTTCTGCTGAGGACTTGAGGCCCTACATGATGCTAGAGTTCAAACTACCCTTGGTGAG
TGGGAAGCTCCTGGATCTCTGATGATGGTAAGCATTTCCAGGGCCAACACTGGAGACAAA
GCCCTTAATACCTCACAGCCCACAGAGAGCTGTATGCTCACTGTGCATTTGACCACGGTT
GGGCCATACCTCTGCAGTGGACCGCCTGTCCTCCTTGCATTGGGGGGTATCCCTGGACTC
TGCAGGGCTGGGAAGGTGGTTGGACTGAGCAGCTGACGAAGCGCCAGGCTTTGTATGTTG
AAGGTCTCGCACCTTGGCATGTGCTTGGATCAATGATGACTCCCCCATAAACATTCCTTG
GAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCATCGTGACTGAGGTCC
AGCACATTGCCTCTGGCAGGGACTATGGCAGTGAGGGCCCATGTCCAGGGTAGCAGTTCC
CTCCACAACCCAGGGGGTGCCCATGGTGAAAGATCCATTTGAGCGGTGCCAGCAAGGCGA
TCTCTCAGTTGGTAGCTCTGGGCAGCAGAGTGCCTGGTGCAGTGATGCTGAGAGTTTTCA
TGGCAGTTCCCCACGTGGGCAGCAGTGGCGAAGGATGCAGCAGGGTGTGCAGGATCTGAT
TGTGTGGATGTGCCCATGCTAAGTGTATACCTCAAGGGTCTGTTGGGTGCAGCTGAGGCT
CCGGTTGCCTGTGTAGTGGGTCTTGGTACTGAGTGCTCCTCTTCTTGGCCAACAGGAGAC
ATGAAGCCCGGTCCTCTGGCTAGCATTAGGTTTCTCTGCTTGTGTTCTGAAGTGGCAGTA
GTCTGCCGCAGGGCTCTGAAGAGATCAGACATCCCCTTGAGTGTGGCATTGACACTTGGC
GGTAGTGCATGTGTGATCCGGTGGTAGGAGTCAACCTGGCATGAATGTTGTGTTCCCTTC
TCTTGGGAGTGTCTTCCACAGAGTAGAGTGGCTCTTGGGCTGGGTGCAAAGGAAATGACA
GGGACAATGGGATGGGTTGTCTCCGAGGACACCCTGGTGAGCATGGTTCCTGTGAGTTCT
GTAGGTGGGGCAGAATGGTATTCCTTGGGTCATCCATGGTGATCCTCGGTAATGTCATAT
TTTCACCCTACAGTAGAGCTTGTACACACGTCTGGGGCAGTTTTGAAGGTTACTTGGTGG
GAGGGATAATAGGCTAGCAATCTTATGTGAACCCTTTGTTGAGAGTGTGAGTGCAGCATA
ATCTGTAGTACTCTTGATCATGGATGAAGCAGGTTTGCAGTTCTGTTTCACGAAGGACAC
GGTACTCTACTTCTATTTGAAATGGACTTCTCTCTTTGCCGGAGACTCCAGTACAGTACC
AGTGATGTGACAGTGTATAATCTGGAGAGTTAGGACCCCGGGCGTGGTGGCTTCTCTCAG
CTTGCAACAGCAGCTGCTGGACACTTCAGGGCCTATAACTCATGCCCCTGGCTCCTGTGC
CTGTAATCCCAGTTTCCTGAGCCCAGATAGTCGTGGCGAGCAGATTAACCTCAATGTCTG
CTGAGGTTAGAGGTTGTTTTTCCAGGGCTTTTGCTGTACCCTGGGGTTCTGAGACTAATC
TGCTCCCTAACACACCTTTTCCTTTGGGGGTTTGGTAATGGGGCCAGGGACATAAACCTG
TCAGATTTCCCTGGTCTGGTAGGTGCTCACTAGTTCTGGTCATGGGTAGTACAGTCCTCT
GTGTTGGCAGGTGTGAGGTTGGATCTTCGGTGGGTTTGAGGGCCGGTTGCATGTTCCCCT
GAGCTGATTTCAGACATTTGGAGGGCTTGTCAGGGATGGGGTGATAAAGGACAGGCAATT
AGCGAGAGGTCACTGGGGGTCAAGTCTGACCCTGGGTGCATCTAGGCAAAGCCACTGCTG
GCCTCCCAGACCTGCGTGACCACTGACACACAAATGAGATTGGGAGATTTAAGAGCACAA
GTGCGAGGTTGGCTGTGTTTGCAGTGGTGCTCTTGCTGTTTCCGGCCAGAACACAGAAAT
CCTGGGCAGCTATTGAGGATGTCCCCTGATCATATTCATGACTGAGGACTGTGCAGGGTA
CCCCACACCTGGCAGAGGTTCTAGGCGACCAAAGGCCTGACTGTGTCTCAGGTCCTATGA
GGTAGTATGCCTTGCACAGCAGTCCTTTCTTTCCCTGTTAGCTGCCACAAATGTGTGGGT
TTCTGTGGACCTTGTCACTCTGGGCCAGATGTCAGTGCCCATCATGATATTGAAGGCTCA
GACACCAGCAAAGCAGTGCTGGCAGGTAGATGCCAAAAATGTTCAGGCAAAGTCATTGAT
GGCAGGACCAATACACACTAGGGACATGGACACTTATGTACCATAACTCGCAACTTCCCA
GAATTCAGAACTCAAGCTGAGAACCCACAGCAGCACACTCAAGAGAAACTTGTATAACCA
GAGTTCATCATGGACAGACTGGCTTGTGTGAAAGGAAGGTTCATAGATGAAGATTGAGGG
GATGTGCTGTTGCGCAGGGAGCAGGGGCATCCTAAGCATTGCAGGTCAGAGCAGGCCATG
GCTCTGTTTTTCTCAAGCGTGCCTGTGGGTTTGTGTGTACTTCTCAGGACTGCTTGCTGA
TGTTAACGTGGCCGTGCAGGGTGGCAAGAAGTGTGCTTCTGCTGAGGACTTGAGGCCCTA
CAAGACAATAGAATTCAAACTGCCCTTGGTGAGCGGCAAGCTCCTGGATCTCTGAGGATG
GTAAGCATTTCCAGGGCCAAATCTGGGGACAAAGCCCATAGTACTTCACAGGCCAGCAGG
CTTTTGCATGCTCGATGGAGGCCTTGGCTGCACCTGTGCCACACCTCTGGAGTGTTCTGC
CTGTCCTCTTTGCCTTGTGGCATGTCCCTGGAGACTATGGACCTCGGAAGGTGGTCAAGC
AGAGCAGCTGATAAAGCACCAGGCCTTTGGTGTTGCAGGCCCCACCCATTGGCATGTGCT
TGGATCAATGATGACTCCCCCATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGA
ACTCACAACCGTCGTTCTCATCGTGACTGAGGTCCAGCACATTGCCTCTGGCAGGGACTA
TGGCAATAATGGCCCACTACCAGGGTAATGTTTCTGTCAAACCCATGGAGTGCTCATGGT
GAAAGGTCCATTAGAGCAGCCCCAGGGGGACGATCCCTCAGTTGTCTGCTCTGGGCAGAA
GATTGCCTTGTTCATTGGTGAAGTGAGTTTGTGTGGCAGGTCCCCACGTGGGCAGCAGCG
TTGAAGGATGCAACAGGGTGTGCAGGTTCGGATTGTGTGGATGAACCCAGGCCATGTATT
CAACTCGAGGGTCTGCTGGGTGTGGTCGAGGCCCTGGTTGTCTGTGGAGTGGGTCTCAGA
ATCGGGTGGTCCTCTACCTGGCCAACAGGAGATACCTATCCTGGTCGCCTGGCTAGCATT
AGGTCTCTCAGCTGGTGGTCTGATGTGGCAGCAGAGTGCCGCAGGGCTCTGAAGAGTCAG
ACATCCCCTTGAGTGTGGCATTGACACTTGGCGGTAGTGCCTGTGTGACCTGGTGTTAGG
TGTCAACCTGGCATGACTGTTCTTTTCCCTTCTCTTGGGACAGTCTTCCACAGAGTAGAG
TGGCTCTTGGGCTGGGTGCAAAGGAAATGACAGGGACAATGGGATGGGTTGTCTCTGAGG
AAACCCTGGTGAGCATGGTTGCTGTGAGTTCTCGTGGCCAGGCAGAAGGTTAATCCTTGG
AGCTCCCTGGGTGATTCCCAGTGATGTCACAGTTTGATCATGCAGTAGAGTTTAGGCACA
CGACTGGTACAATTTGGTTGGTGCCTTGGTGGGATTCTAGGCAAATAATGTGCTGGGATT
CTTTTGCTGAGGGTGTGAGAGCCACGTAATCTGTTGTACTCTTGACCATGGATGAAGCAG
GTTTGCTGGACTGTGCCACGGAGGCCAAGGTACTATGCTTCTCCTATTTGAAATGGACAA
ACCCCCTTTACCTGGAATCAGAGGCAGAACCAGTGATGTGGTGCAGTTAACTCAGGAGAG
TTAGGACCTTGGACATGGTGGCTTCCCTCAGCTTGCACAGCAGCTGGTGGACACTCCAGG
GCCTATAACTCATGCCCCTGGCTCCTGTGCCTGCAATCCTGGAGCCTGAGCCCAGATTGT
CTTGGCCAGTAGAGAAACCTCGATGTCTAATGGGGTTGGAAGTTGTTTTTCTGGAAACTT
GCTGTACCCTGGGGTTCTGAGACTATTCTGCACCTGAACTTACTCTGTCATGGGCAATTG
AGTCATGGAGCCAGGGACATAAAGCTTTTGGTTTTCCCTGGTCCGCTGGTGCTCACTTGT
CTGGTTGAGGGTAGAGCCGTACTCCTGGTTGGCAGGTGTGAGGTTGAATCTTCGGTGGGT
TTGTGGCCCGGTTGCATGTTCTCCTGAGCTGACTTCAGGACATTCAGAGGTCTAGCCCAG
GGTCAGGGCAATGAAGAGAGAGGTGACTGGGGGTCCATTCTCACCCTGGGTGCATCTGGG
CAAAGCCCCTGTTGGCCACCTGGACCTGTGAGGCCACTGGCACACAAATGAGATTGCGAG
ATGCAGAGGTGCAAGTGCTAGGTTGGCTGTGTTTGCAGTGAGTGTCTTGCTCTTTCCGGC
CACACAAAGAACCCCTGGGCTGCTGTTGAGGAAGTTCCCTGAGCCTACTCACGACTTGGG
ACTGTGCAGGGTACCCCACACCTGGCAGAGGTTCCAGGTGACCAAAGACATGACTGAGTC
TGAGGTCCTGGGGGGCAGCATGCATCACACAAGCGTTGCTTTCTTTCCCTGGAAGTATCT
GCGGGTTTTTCGGGGTGCCCATGGAACTTGTCACTCTGGGCAGGATGTCAGTGTGCATCC
ACGGTATTAAAGGCTCAGACCCCCAGCTAAGTAGTGCCTGCCAGTATATGCAAAAACTGT
CCTGGCAAATGTCACTGGTGGCAGGACCAACACACACTTGGGACACAGATGCACATATAG
CATCTCACGCATCTTCCCAGAATGTAGAACTCCAGCTGAGAACCCACTAGGGCCTATTCA
GGAGAAGCTGGTGTAGGCCTTGTCAATCATGGACAGACAGGTTCAATGACAGGAAGCCTC
AGGGATGAAGATTGATGGGACGCGCTGTGGTGCTTGACACCACAGCAGCCTAGCGTGGCA
GCTTGGAACAGGCCAGGGATCAGGTTTCCTCAAGTGTGCTTGTGGTTTGTGTATACGTCA
CAGGACGGCTCGCTGACGTAGATGTGGCCATGCAGGGCGGGAAGAAGTGTGCTTCTGCTG
AGAACTTGAGGCCCTACAAGACACTAGAATTCAAACTGCCCTTGGTGAGAAGAAAGTTCC
TGGATCTCTGAGGACGGTAAGCATGGCCAAGACCAGCACTGGGGACAAAGGCATAGCACT
TGACAGCCCCACAGACACCTGTATGCTTGCTGGAGACTTTGGCCACGCCTGGGCCACACC
TCTGCAGTGTACCGTCTGTCCTCCTGCGCTGGGGTGTATCCCTGGACTCTGGAGGGCTGC
AGAGGTGGTTGGGCGGAGCAGCTGATGAAGCACCAGGCCTTTGGTGTTGAGGGCCCCACC
CATTGGCATGTGCTTGGATCGATGATGACTCCCCCATAAACATTCCTTGGAAAAGCTGAA
CAAAATGAGTGAGAACTCACAACCGTCATTCTCATCGTGACTGAGGTCCAGCACGTTGCC
TCTGGCAGGGACTATGGCAGTGAGGGCCCACGATTAGGGTAGCAGTTCTCTCCACAACCC
AGGGTGTGCCTAAGATGAAAGGTCCATTCGTGTGGCTCAGGAAAGCAATCACTCAGTTGT
CCATATGGGCAGCAGAGTGCCTTGTGCAATGGTGCTGTGAGTTTGCTTGGCAGCTATCCA
TGTGGGAATCAGTGGTGAAGGATGTAGCAGGGTGTACAGGGTCTGATTGTGTGGATGTGC
CCAGGCCACTTGTTTCCCACGAGGGTCTCCTGCATGTGGCAAAGACCCTGGTCCCTGTGG
GGTAGGTCTCAGAATCAAGTCTTTTTGTCTTGGCCAATTGGACCCACGAAGCCCGGTCCC
CTGTCTAGCTTTAGGTCTATGAGTCTGGTGGTCTGATGTGGCAGCAGAGTTCTGCAATGG
TCTCAAGAGATCAGGCATCCCCTTTATATGGCATTGACACTTGGTGATAGTGCATGATGA
CCTGGTGGTAGGAGTTAACCTGGCATGAATGTTGTGTTCCCTTCTCTTGGGAGATTCTTC
GGCAGAGTAGAGTGTCTCTTGGGCTGGGTGCAAAGGAAATGACAGGGACAATGGGATGGG
TTTGTTCAAGGACACCCTGGTGAGCATGATTGCTGTGAGTTCTCATGGCCGGGAAGAAGG
TTAATCCTTGGAGCTCCCAGGGTGATTCCCAGTGATGTCAGAGCTTCTTCATGCAGTAGA
GTTTGGGCACACGACTGGTACAATTTGGTTGGTGCCTTGGTGGGATTCTAGGCCAGTAAT
GTCCCGGGATCCCTTTGCTGAGGGTGTGAGTGCCACGAAATCTTTTGTACTCTTGAGCTT
GAATGAAGAATGTTTGCAGGACTCTGCTACAAAGGCTCGGATACTGTGCTGATCCTTTTG
GAATGGACATCTCCCTTTACCTGTGCTTCCAATGCAGGAACAGTGAAGTGACGCAGTTAT
TTCAGGAGTGTTAGGACTTTGGGCATGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved