Oryctolagus_cuniculus Locus Mono:24:SNORD29
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:24:SNORD29
Oryctolagus_cuniculus
Mono:24:SNORD29
scaffold_210631
SNORD29
1001..1065
2065
CTAAAAGGTGACTAATTCAGCAGAAGCATTTGTGCGGTGATGTGGGTGATGTGTTCTGA
TGGCCTCCAGCAGTTAACTTCTGTCCTTTTTCCAGGAGTCAGAGTTCACTCCTCTATTAA
GAGATAGATATACTATCAGAATCAGACTCTTTTTTTAAGTCTTCAAATCAAAATTGAAAG
ATGGTTGCAAACTTTCTATCTGACCCCAATGTGCTCCCCAACTAAATCTTGACAACCTCA
AGTGCTAACTGTCTAAAGCTGTTAATCAGAATGCCACAAAAAAATACCAGTTGGGCACGG
ATGGAGACAGAAATATGTCTGAGGTGGTGTAAGTTTCTGTGGTGTCCTTTTTAACTGAAA
GAGAGTGCAAGAGAGAAAATAAACTAAGAATTGAAAATGAATGGGCGCCAGCACCGTGGC
GTAGCAGGTAAAGCCTCTTCCGGGTCTCCCACATGGGCACAGGGGCCCAAGGACTTCGGC
CATCCTCCACTGCTTTCCCAGGCCATAGCAGAGTGCTGGATCCGAAGAGGAGCAGCCGGG
ACTAGAGCTGGCACCCATATGGGATGCCGGCACTTCAGGCCAGGGCTTTAACCCGCTGCA
CCACAGCACTGGCCCCAGCTCTGACTTTCAAATAAATAAATAAATCTTAAAAAAAAAAAA
AAAGGAAAATGAATGACAATTTGGTAGAAGCAGCACCAGTTCAATACTGTAAGATTTTTT
TTTATAAAAAGATGGATGATTTCGAAAGATGAAAATATACAACTGCCCCCTAAAACTCCC
TTGGATATGGCTAGGCTTGATCCAGTGAATATTTCTTCCTTAACAAAGTCATCACACAGT
CTGCCACATACTGGGGTTACTGGTGCACATGTCTGTCTCTCCTGTTGGAGTGCAAGGACT
TAAGCAGGAGCACACTTGGTCTACTTACTTTGTATATTCCACAGTGCTAAGGACAGTGCT
TTTCACAGAGTAGAGCATTTTCTGAATTAAACCATAATCTGTTTCTGGGATGAATCAAAC
TAGCTCACAATGGCTGACAGCAAGAACACATGAACACCTGAGAAACTGGAGAAGACAGGA
ATGGGGGACAGCATGTATAAGGAATCTCTCACAAAAAGCCTGGTCTTGTCTCTGGGTGCT
GTCACCAATGACCTCCTTGTTAGCACAAGGGTCCAATAGTTTGGATGATTTGTAGGAAGC
TAAGCTGTGTTTCAGCTCAACTCCAGCCTGAGATTAGAGTTCTAGGGAGAGAACCAAGTG
CATATAAATGGAATCCAAGTCTTGGAGGATGTCAGAGAGGAAATTTTCAAATCCTTTCCT
GGACAACTCAAGCTGTTCAAGCTAGCACACAATAATTTTAGTCTTCTTAATAAACCTGCT
TTCCCTGTTAAAACAAAACAAAACACCATGATCTTCAAGAAAGGAAAAAGAGCCTAACTG
GGACAAGAATAAAGACAAAGCACCTGAAGGAGTTAGGAGCTGTTGGGAATAGATATGTTC
TCTCTGGAAATCTAACTTCCAAACTAAGTCTTGAGAAAGAGAGCACTTCAGAGAGAACCC
AAGTCCTCGAGGGAGGAGAGAGAAGAAATCTGGATGAAAACACAATCCCAAAAAGAAAAT
GGTGTCTGTTGATATATCATAGCATTATCCATCCATTTATACAATAGCTTTCTACCACCA
CCACTCTCGTCATAGGTGTGTGCACGCACGTGTGCACCCCCCCCACACACACACACTTAC
CTATGATGCATCGTAAACCATGTTCAAGGAGGCCCTCAAGCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCAGGACATTGCCAGCAGATATCTAACTAGAGAGACATAT
CTTTAATTGATTAATATTTATCAATGAACAAAATACAGTCGTCAGTGCACAGGATTTTAT
TCAAAGCTAATCAGCTGAGACGCAGCCCTTCTCTGTCATAAAGGAAATCCGTGGGAACTA
CACCATCTCCAGGATTGGGCAAACGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved