Oryctolagus_cuniculus Locus Mono:99:SNORD49
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:99:SNORD49
Oryctolagus_cuniculus
Mono:99:SNORD49
scaffold_183061
SNORD49
1001..1071
2071
AGCAGTACAAAAACTTCACCAACTGTATAGGAAACCAATTTGTTTTACATAAAATGAAA
GACTGCATTTCAACAAAAGCAGTGTCTCGCATACATTCTTCCAGTATCTCAAATATGGAG
GACTGGGGAGGGGGCGGGTGGAGGAAAGGATCAAGAACAAAGCAGCCCCAGCAGGAAATC
GTCAGGCTGGAGTGTGAAGTCTTGAGGGATGGGGGTGGGGGTGGGGGTGCCAGCGCGGTG
ACATCCAAGAGGAGGACTCCAGAGGAAAAAAGAAGGAAGCAAAAATCAGAGAGAAGCCGG
TGAGGTTCCTTTGCTGGGTTAGGACAACGGACTTTTGAAGTAAGAAGAGCTGGTTTTGGG
GGTACCGAGTTAATCACGCTCTTCTTCTGTAAAAGACCCTCACGTCTCACCACTAGTTAC
AGTTCCAATTTTATAACAGAAATTAAAAGAAAAACCACATTTACATGAAAAAATAGTTTT
ACAATGAACCAACAGAAAAATATCTTCTATTAGGAAGCAAATCTCACATACAGACGCAAA
AAATAATTAGGGAAACAGCAGAGTTACCACCGGGAATACAAATGGAGAGAGAGTCTCACA
GGCTGATGCAGCTGAGGCTGGGGCTTCTTCTCAAAGGATACACCTAGACTCCCGGAAACA
AGCCAGAACTGGTTTCTGATATACAGTAGTTCCAAAGTACAATTACTCTGAGAATTCAAG
ACTCAAAGAAGAAAGAGTGCCGCATTACGAAGGCGAGAGCATCAAACTGATCATGATGTC
TTGGGACCAGTTTTGCTGCTTCCTTTTCCTAAGGAGTGATGCCTCTACTAGACATGCAGG
GGAAAGCCAAGTCCTTAGAGCAGGCATTTTTGATGCTGAAACCTACATTACTGTTTGTAT
AACATTCTGGACATCCTACACTTTTCCTAATTATCTAAATTTTTCAAAAACAGGATCCTC
ACTTGAAATGCCTAAATTTAAGCTTGTAAAAAATGAGACCATGGCCTGATGACACCAGTA
ATAGGCTGTGCCCTCAGAAGCGTTAACTGACCATGTTCATGTGTGTGTGGGGCGGGGGGT
TTCATAATAAAGAACTAGGTAAATGCAATAGGACACATCTAGATAATGCAATACTTAGTG
GGATAAGTTGACATGGAAAGACATTCATAATAATAATAATAATAATAATAATAATAAAAG
ATGGGGGGAAGGGTTCCAAATCAGAACAGAAAACAGGTATATGGTATGATCCCATTTTGA
AAAAAAGAAACATCTTCAATATATAGTGCATATTATATGTATCTCATTTACATATATTAT
ATAAGTTGTATATAGACACACCCTGGGGGGGAATCAGGAAGGATACACCCCATTATCGGA
TTACAAGTGATGTTCTTTTATCTTATCTGCATTTTAAATTTTTTCTAAGATTAATATCTG
TCATAAAGTTTGTATAAATTCAAATTGTGTACCTAAAAAGTTTATGGTTTTAACCACAAT
GTTACACTGTTTCCACCATATGATCACTACAATTGTACTACAGTGTTGATGTTATTACAT
AAGTATCGTTTGCTTATCTTCTGTTGAACAGTGGTTTTCTATTATTTAAGACAGAACATT
TCACTCACTAAATATACTAAAATCTAAAGTTTTTATAAAGTAGGAGGACATGAGAATATA
GCATGAAATGAAATATGGAATTATTCTATGACGTGTGGGTTTTCACTGTAAATCTGCAGT
TAAAATTTTATGTTTTTCTTCTGAAAAATATGGGTATTAATACTTGCCTTCCAGTATTAT
GAATAAAACAGATAATGATTAATATTGTATTTATAGTAATTACTATAATAAATAAATCAT
TGGTGCTACTGTTTACTTAGTATCTTCTAGGTGATAAAAGACATAGCACTGAGAACTACA
TAGATTATCATTCCCTTTTCACTTGTTAAGTGGGTATTATTTATGATCTACATTATATAA
GAGGTCTTTAAAAGTTCATGGAAAATAGATTTTATGAGAAAACTATGCATGGACTTCCAA
TCTTTTTACACCAAAATAAACTTGTCTTTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved