Oryctolagus_cuniculus Locus Mono:173:SNORA21
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:173:SNORA21
Oryctolagus_cuniculus
Mono:173:SNORA21
scaffold_43948
SNORA21
1001..1142
1361
CGATGATCAGTTGGGTGTACAAGCAAGCCACTATGACTCTGTTGGGTTTGGGAGTTACT
ACTAATTTCCTACAAGGCGTCAGCAGAAATTGAAGGCCACGAAGCAAGTCATTGTTGTAA
AGGAATAACAAAGACATCAGCCCAGTATCAATTAACTCAGAAAACTCCTGGGAATCAATA
TGTATAATCACTTGAGGATGATTACTAGAAATTTGAGTTTTCCCTTTTAAAAGTACTCAG
TGGGCCTTTTGCTAATGACCCACTGAGCTGTCCAGAAGGAGCAGAGCCAAAAACACCACT
TTTGGGTGAAGTGGCAGCACTTGTGCTGTTGTGTTTTTGCTTCAATCAGTGGTGTGACAA
GATATTCCACTGTGGGGCACAAACCACAGGGGCAGGGAGCAGAGCTGGAGAGACTGGGAA
ATGTTAACACTGGTGGAGCTGCCTATCTTGTTAAAAAATGAAGTTTTGCTTTTATCTTAA
CATAGAAAAAAAAAGAAATTTGAGTAAGGCAGCCACTAGCAGAGCTCCAAAGCCTTGGTC
TCCCTGCAAAACTTCATTACTAGAGGTAGAAATAAATGGAAGAACAAGTAGCTGAGCCAC
AGAAGTTTGAGAGGGAAGTTCTTGGGGTAAGTCTAACTACAATTGAACATAAATAATCCC
TGTATAATAAGCATCTATTACTCTGGGAATGATGGAAATGTCTTTTTTATAGGCTTGGGA
TGTTGGCAAAACTAGTCCCGTGGACTTTGCAGGTAAGGGGCCTGTTAATTGTGTAGAAAA
TTTATAAACAGCTCCAGGCACTTCAAGAGAAATTGGCTCTGAATATACAAATCTATTCTG
GCACTGTGGGCAGTAGTATAAAAGGACTATTGGAGGGTTGTGGGAGGGGATTGAGTTGTT
GGACAGTTAACATCCTCTGTTGTGTTTGGCCTGAGGGTTGGCCAGACTTCAAGTTTCCCG
AAGGGACAAACAACACTGATCAGCTCAGTGATATCCTTTTTGGCACTGTGGACACTTTTT
TGAAGGTCAAACTGATTTGGTAATGACCAAAAGTTTCTTTTAAGATGACCTTGCTTTCCA
CAGCCACAACATTTTTTATCAGGAGCCTTAAGAGCAGCAGCCAGTAAGTTAGTTTTGTAA
GTTTTGGTCCATATATTTTGACATAATTCGATCATTTCTGCAATGGTAGTTTCAGGCTTA
ATGCAGACCGCTTTTAATATATTTTTGCAGTTGTAGTTAGCATTTTCATAAGCCATTTGT
TTTAATGATACTTTTGTTACTTCCTGATTATGTACTTGACATCCAGTAGTTTTTTTTCTA
GCCTGCCTGTAAAGGACATGTAGCCTTCAATCATCCCCTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved