Oryctolagus_cuniculus Locus Poly:28:SNORD58
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:28:SNORD58
Oryctolagus_cuniculus
Poly:28:SNORD58
GeneScaffold_5759
SNORD58, SNORD58
1001..1068, 3041..3104
3124
GCACCGTTCTTACAAGGTGGCTGCAGTGATGCTTTTCTTAGGACACCTTTGGAGTTAGC
CGTGAAATAACCAATCAGTTCTGAGCGGCCATCTTTGATTTGAGTATTGATCATCCGGGT
ATCCTGAGCAACGTTATTTAGGATTTGTGGGAAAGCAGTCTGCAGCTCGAGGTGGGACTT
AGAATTACGTCCAAGATGACCGGGTCTGAACGTTTCATAGCAGGCAGGGGTTTAGGGCTG
CTTCCCCCTCAGCCACAGGGTGGTTGACATTGGACTACCTCACCTCCCAAGAATGGAGAA
GGGTGGTTTTTTAACTGCTGGTCCGTGTTGACATTTTGACAGTATGCAGATTGCTTGCTT
AAGTATGATTTGACATAAATGACAAATATTTGTGTTCATACTTAGAACACTCGAGAAACT
GCCCAGGCCATCAAGGGTATGCATATCCGAAAAGCCACCAAATACCTGAAAGACGTCACG
TTAAAGAAGCAGTGTGTGCCATTCCGTCGGTACAATGGTGGAGTTGGTAGATGTGCCCAG
GTAAGAATTCGTAGTTCCATAACTGCAGGGAAACCTGAGATGGAATGGCTAAGATGGGCC
TTTATCGTGCTGTTTCTGGTTGCTGTGATGACAAATCTTAGGACACCTTTGGATTAACCG
TGAAATAAAACACGTTCTGAGCAACCCTGATGTTGTAGCAAATACATTCATCTTGTTTGC
AGTGTTAATTTAAAGAAGTCACTGATTATCTCTTTTCATTTTCTTTCAGGCCAAGCAGTG
GGGTTGGACCCAGGGTCGTTGGCCCAAAAAAAGTGCCGAGTTTCTGCTGCACATGCTTAA
AAATGCAGAGAGTAATGCTGAGCTGAAGGTATCTAGGCTGTTGGCATTCTTAAACTTGTA
AATATGTGCTAATGACACTGATATCTTGATTGATTATCTTTCTCAATAACAGCCTTTTCA
TTTACTAAAATCTCTACCTCCTGCCTCTGGCACGCCATAAAGACTCAGTCTGCCCATGCC
TAAGACTTAATTACTAGTATTTCCCTTATTGAGGTACTTGGAAAAGAAACACTTCTGCCT
TCTGTCTTTTATATTGCTGGTATTTCACTAGGAGTTCATTGTGAAGTGGGTTTTTGGTAG
TAAGTCAACAAAAGGATCGGGTTGATGGTGGTTAATGTGGTATGTTAGAGTTATAATGAA
GGGAATGTTAAACTTCAGAAGTTAAAACAGTGATGGTGGACAAAACACCAGGGTTTATCC
TTTACTGTTCTGCATTTGAAAGCCTAGATCAGAACTGGAGTTCTGTGTAAAGTCAGTGCT
TAGAGGTGCCTCTGCTTTGTGCTCAGCTCCTGTTGAACCACCTTTAGGGAGGCTGCTTAA
AGTTGTGGCCTGTAAAAGCGAAAGCAGACACAGTGTAAATGATTCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCATCGAGATGATCCTCACTGAGAAGGAACAGATAGTGTC
CTAAGCCAGAAGAGGAGGTGGCACAAAAGAAAAAGGTAAACCACTTAGTGGTTCTCTGTC
CAGTTGAGGGCAGATTTGGGGTTGCTGTGATGGCTATCTTAGGACACCTTTGGAATAACC
GTGAAAGGAAATTGTTCTGAGCAACCCGTTCAGCCAGTTTTATCATTCATTTTTAATATA
CTTGCTTGACTTGCTTGACTAACAGCAAGGTTGTGATTGGTAAAGTACATCAGACCCCCG
TGATTTGCCTATGGAGGCACAGCCACTTCAGACAGGGCAGGCTAAGCCACGCCCCATACT
CCACACCTAATGGATGGAGCATGCTGCTTATCAAGGAAATACCCGCCATCCTTTCTCCGC
CTTAGTCCTTATCTGCCAGGCTTCCTGCCGCCTCTGTTAAGCATAAACTTTAAGTCCTCC
AAGAATTTAACAGTCCTTTTGTTTTTTCTCTCCCCAGATATCCCAGAAGAAACTAAAGAA
GCAAAAGCTTATGGCTCGGGAATAAACTCAGTATAAAATAAATACGAATTAAAAGAACGT
TGGTTGTCTTTATTAGTAAACCTTTTATGTCTTCATAAACGCATCAAATGAGTTCTCTTA
GGATCAGAACTCAAATCCGATTTTGGTGTGCCCCCTGCCACTCAGTGTTGATCCGTGCAT
ATGCTGCTGTGAGGCTCTTGAATATGGGGGGTCTTGTCAGCAACTTTGGGATGTAGCACA
CTTTTCAGTTTACCCAAGTACAACGCAAGCCCTTGTGCCGTATTTAGTGCATGTGTTGCA
AGTTTTCTTCACCCTGAGAAGGAAGGCTGCGGTTGTTAGTGGTCACTCTCCAATCACTTG
CCTGTTTTCTGGTAATAGATTAACAGTGTTTGGTTAAGATGGGGACCTGACCCGTGTCTC
AGGCCTTCATAGCATGCCGTGGGTTATGCCACAGTGTTCTAGCCGCCAGGCATCCCTGGG
TCCCGTAGGGGTGCTCTGCCGCTGCAGGTGTTCTGCGAGGGCTTGGTGTCAGGAGGACTT
GAGGGTGGGGATAGCGGGGTTCAGGAGGCGGCGAGGGCTTGGGGTGCTGCGGCCGGTTTC
CACTGGTGATGTCTGCGGAGAGGACGTTCTGCAGGGCAAGGTGGTAGAGACGGCGTCAGG
AGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved