Oryctolagus_cuniculus Locus Mono:190:SNORA29
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:190:SNORA29
Oryctolagus_cuniculus
Mono:190:SNORA29
GeneScaffold_23
SNORA29
1001..1130
2130
TGCATACACGGCCCCATGTGGCCCCCGTTCAAAACCAAGACAAGCAAGCCCTTCAGGCT
TTATCAGGAAACCTCTCAAATCAATTTTTGGGTGCTGCTTCATCGATGGGTTAAATTCAG
GCAGCAACCTCCTCGGCCCCTGCACTTCGGTAAGTACCTGTGCCAATCGCCTCCCCCCAG
CGCCCGCTCCCTCAGTCCCAAGCCCTGGGTTCCAGCCCCACCCCTCCCCTTCCTCTTCCT
CCAGGCTCCATCTCAGGGAGGGCAAACACAAGGCGTCCTCTCCTGGCCCCCTACAGACAT
AGCTAATCAATCTCCCACGTGGTCCAACCCGGCAAGTTCTCCACCACAAGATCCCCACAA
ATGCAGTTCGAGAGCCTCACCAGGCCATCTTTTTTTTTTTTTTTTTTTTTTAATTTTTTG
ACAGGCAGAGTGGACAGCGAGAGAGAGGGACAGAGAGAAAGGTCTTCCTTTTGCCATTGG
TTCACCCTCCAATGGCTGCTGCAGCCGGCGCACCGCGCTGATCTGATGGCAGGAGCCAGG
TGCTTCTCCTGGTCTCCCATGGGGTGCAGGGCCCAAGCACCTGGGCCATCCTCCACTGCA
CTCCCTGGCCACAGCAGAGGGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGCGC
CCCCAGGCCATCTTCTTACAACACAAATCATTTCAGGGACCGGGGAATCTTACGCAAGGT
GTTCCAAAACACAGACAGAAGGGGGGGGGGCATATTTTTATGAGGTTAGCATGCCCTTAA
TTTCAAAACCAGATGAATTTCCAGAATTAGAAAATTATACATCAATTCCATTTATGATTA
TATATGCAAAAACACTAAGTAAAATTGATTCAACATTAGAAAATCTATAAAGCAAAGGAT
AAAAATGGCATTTAACTAATTAGATACAGAAAAAGCACTTGATAAAAGTAATACCTACTT
GCAATTAGGGGAAAAAACTCCTACTTGATAAAAATTATCTATTTCCCATTTGACTACACA
TTTTCTCCAGTTAATAGAGTTCAGTGGCTATGCTTAGTGGATAGATTAAAATTGCCATGA
TCTGACGAAGAGGGAGGGGGTTTGAAATATGAAATGGCTGAACAGAAAAAAAGTTATGAA
CCCCGAACCAGTAGAAAGCCTGGACTTAATGCAAAATATAGACTCATTTTCTTTATTATC
AAACATAAGGAAAGAGACGTCCGCCAACAACATGATTTTGGAGTTCTGGCCAAGACCCTA
AGGCGAGCAAAAAGAAATCAGAGATTAGATCCTGGAGGGCTAACACCAAACCGTCACCAG
CAGCACAGAACAAAACAAAAGGGAAAACTCAAAGAATCAGCAAGTGACTATCTACAGGTT
CAGAAAGCGCCCACACAGCTCACAAATTCTGCTAGAACGGAAATGACGCGTTCATTTCAT
GTCGATGGCCTCCTGGGTTATAACTGGATGGTTTCCCATCACCAGGAACAAACTGCAAAA
ATTCCTACATTCTTTAGTCTCTGGACCTGCGGCCTCTCCAGCGCCCCCCTCTCCCTGAGA
CCTGCCACTCACCGCGACACACACACACACACACACACACACGCCCCGTTCATTCAGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved