Oryctolagus_cuniculus Locus Mono:74:SNORA70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:74:SNORA70
Oryctolagus_cuniculus
Mono:74:SNORA70
scaffold_183795
SNORA70
1001..1127
1180
TTGTCTAGGAGTAAACCCGGGACAGCAAGAGGGCATGATGAGGAAGTGAGCCTTGGCAT
GTCTCAGAAATCACAGATCAGCTCGGGGCCCCAGTGTGCAACAGCTGCAAATGGCAACCT
CCTCCATGGTGTATACAGCCTGCTGCTTGTATGGCAGCCTTCAGGGACCTTGGGGACGGT
CCTTTCCATTGGACCTTGGTGTCTGAGATGTTGTGTTGTTCCCAAGTTTGATTCCAGCCA
GCCATGGGGGTGCCTTTGGAAAACCCTGTGTCACAGTGGCCAGGGTTCACATTGCTCAAG
TCAGCTTGGCCATCTGCACCAAGCTGCAGAACAAGGAGCATGTAATATATGCAAAATTCA
AATTAGTTTGCCAGCTCCTCATTTCTGGTCTGAATTTGGACTTGGACATATTATGATTCA
AAGTATTTAATGACAGCATAGGTTAATTTCACAAACAAGCTGTCTTTAAAAGGTCAGCTT
TAGGAGTGTGTTTGGCATAGTGCTTAAGCTGTCCTTGGATGCCGGCGTTCCGTATCAGGT
TCTAGCTGCTCTGCTTCTGATCCAACTTCCTGCTAATGCACACTCTGGGAGGCAGCAGAT
GAAGGCTCAAGTATGTGAGTCCCTGCCTAACCCCGGTGGGAGACCTGGACTGCGCTCAGC
CCTGGCTGTTGTGGGCATTTGGGGAGTGAATCATTGGATGAAAGATCTGTCTTTCTGCCT
TTTAAATAAAAAGAAAATAAATTTAAAACATTTAAAATTTTCTTTCTAAAGAAAAAATGA
GAGCACATCTTTTTTTTTAAAAAAAAAGATTTATTTATTTATTTGAAAGTTAGAGTTACA
GAGAGATGTTGAGAGAGTGAGTGAGCAAGTGGTCTTTTAACCACTGTTTCACTCCACAAA
TGGTCGCAATGGCCAAGGCTGGGCCAAGCAGAAACCAGGAACCAGGAGCTGTATCCCATA
TCCCATTCTCCCATGGGTGGCAGTGGCCCAAGCCATCCCCTGCTGCTTTTCCCAGGCTAT
TAGCAAGGAGCTAGATTGGAAGTAGAGCAGGTAGGACACAAACTGGTACCCTTTTAGGGG
TTGCTGGCATTGTAGGTGGCAGCTTTACCCAAACCCACCATGCCACAATGCCAGTCCCAA
GAAAGCCTATCTTGGTTGACAAGCAGCACTACCTGGAGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved