Oryctolagus_cuniculus Locus Mono:129:SNORA74
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:129:SNORA74
Oryctolagus_cuniculus
Mono:129:SNORA74
scaffold_108253
SNORA74
1001..1202
2202
TTGGGCTAGGGAGATTCCGGGAAGAGGCAGGTAGAACCTAAACCTCTCACAAGAGATAA
TATAGATAATCAGTCACACCTGTAACCTGCATTTATCACCTAAGTGTTTTATTGTACCCT
TGTAATCAATAATTAAGAACCTTATTGGGAACTCTTTGTAACCTTAAGAGCCTTTTTGAT
ATGTAAATCTTTTGTGCTCCTTCTTGTAAACAACTGGTCATGTTTAAATACTACTGGATT
TATTCAATAAACGAGCTTGATCAGGACTTGTCTTGGCTCCATTCTTTGCGTCCTTGTCCC
CGCATTCCCACTCTCTGTTCAGGAAGACCCAGTTCATTGTGCCGCAGGCCGGCACATCTG
CCCAGCCTGGTGGCTGGTCAGTATCCATCAGGAATATTCATCCGTATTTATTTGCCTCAA
CAAATGCAGGCTCTTTTTTTTTTTTTTTTTTTTGGACAGGCAGAGTTAGATAGTGAGAGA
CATAGAGAAAGGTCTTCCTTTTTCCGTTGGTTTACCCTCCCAAGTGGCCGCTGCGGCCGG
GAGCTAGGTGCTTCCTCCTGGTCTCCCATGCGGGTGCAGGGCCCAAGCACCTGGGCCATC
CTCCACTGCCTTCCCGGGCCACAGCAGAGAGCTGGACTGGAAGAGGGGCAACCGGGACAG
AACCGGCGCTGGCTAAAATAGGTAGTTCCATCTCGGTGTGACATTAGGGAGATGGTAAAT
TCATCAAGAGAAAGGACGGTGTATCTAACTTTGCTCATTGTTAGGTTCCAAGTACAGTGC
AATGTATTTGGCGCGAATTACCTCAATGTTGGGCCAAAACATTTAGGGGCTCCCTTTAGC
CTGAAAGCATGGGAATGGGATTCCTGTCTTGCTGCCAGCCGTCTCCCTTAAGCAGTCATT
GCTTCTGTGTATGTTTTTCAGTCAGCATCCAGCTGATAATGATGCCTTCTACCTGGGCTG
CCCGTGTGTCTGAACAACTGAGAAAGCTGTTTCAGGAATAACCCAGCGGTTGTCAGCTGT
CCAGGCTTGTATGATGCCTGTGATGGTGTTACACTGTTGGGAGAGCAAACACTGTCTACA
CTGGGTTTGGCTCCGAGCACTGTTCTGGTGTGTTGTGGGCAAGAACCCTTAGGCAGTGTT
TTGTGCCTCTGAGAGTGGAATGACTCCTCCTGTGGGGTTGGTCCTAGTCTGGGTACAAAC
AATTTATTTCTGTTAGAACAGGACCCTGTCTTTGGGACAGGGCAGCCTGTCACTCCTTAC
CGTCTCCATTCCTAGATGCCATCTCCTGTGTGAGAACCCTGCCCCTGTTGGCACCTCAGC
TGCCTGACAGTCCTTGGTGAGACCCAGGTAAGTAATGTATTTTTGTACATTGTCCTTTTG
TCATGAAGATCCCAGTTGAATTACATAAAATAATGTAAAATTCTACATTGCTGTTGCACA
GCAGAGGTCAGCTAACTTCTGTCACACTTGTGCAGCCACATGGTTGCAGTGCTGCTACAC
AAGTAGCCGTAGATAATACTCCAGGAAATGAGCAAAGCTGTGTTCTAGTAAAACTCCTTC
AGCCATTTACAAGTTTCAAAGCCATTCTTATTGGGGGCCATTATACAAGTAGCAGGCTGG
AACTGGTCTGTAGGATATGGTTGGCCGAACTGTGTTTTAGAAATTCAGGCCTTGAGGTGA
TAGGTAGAACAGCAGCCTTCAGTTTGCTGTAGAGCCTTGGCTTACAACCTCAGCACTACT
GAGATAGGAATGTTCCCTGAGCATAGAGGGAATTTTGGTGTGTCATCAACAGTCCCATGG
GGTTTTGAATCTGGAGTCTTAAGTTCTTCAGAGGATACAGGTTGGCTTCCTCACCACTGA
AGGTGTGTCTGAGCAGAGGTTGCTATGTTGCTAGTTGAAGAGGGATAATTCATTTGGTGT
TTGTGTGTCTGTTTTCAGTATCCCAGGAGGCTTCAATGGCATAATCATGCACATTAAAGT
AATTTAATGGGATTTCCTATTTGATAAGTGAAGTTAATTAGTAACATACTTATCCCTGTT
GACTTTTTTTATAAGCAAATTTATTTCCTGGTGAGTCTAAGCAGATGAAGTAAAACATTG
CAAAGTAACTTAATTTATTCCTTCTCCTCTATCACTCTTTTCCCATGCTGCAGAGGAAAC
TGGAATTAGATGGTCAAGATTACTGATCTAGAAGTATCAAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved