Oryctolagus_cuniculus Locus Mono:0:SNORA40
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:0:SNORA40
Oryctolagus_cuniculus
Mono:0:SNORA40
scaffold_208985
SNORA40
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCCAATGTCTTACAGGCAAAGCTAAATGCCCATCTGGAGCTGACATTTT
ATACTATGTTATCCATTAGTCACCAGTACAAACGCAGGCCTTATTATTTGCTGTGTGAAA
CCAATGTCTTTGTGACTTGAAGGTATTCAGGGTTAACGTTAGGGCAATATATGTTTTTTG
CTCACAAGCCATACTGAGTTACAGCTAAGACTAGTTGATATTTCACAGTTTATACAATTA
CAGAATTAACTGCACATGCTGCATAAACTATAGGAAAAAATAGATATGAGTTATATCTAC
ACTTTAAAGAGAATGTGTATGCTTATTATTTTAGTGGAGTATATTAGGATATGTGGAGTA
TAGCAGTATAACTGAGAACAAGTCCAGGGACATCAATTCCCAAGTTCTATTCCTAATGTA
TCTATTGAGGAGTTGTTGGCCATTGTCACAATAGAGCTAAACTTGATTCCCTATCTTGCA
AGATGAGTGTGTTGAATTAAATGATATCAAAAAATCCCAACTGCACTTATGCATGTTTTT
GTCTAACTTGTGGACAAAGACTGACATAAAGGTACAAAAAATAAATCCTTTTTTACAACC
CAGAACTCATTGATCAGTATGAGTTTTGATACATACAAGCAGGAATAAGATGAAAATAAA
AGAAATTCCTTTCATTCTTATGAATTTTATGATTCTAAGCTATTGTCATGATTATTACTC
TTACATGCTTTAGTTGTAGAAGATTGTTTATACTAAGGAGTATTTGGTGATACTCAATTC
TAGATTATTTTCTTCTTGAAGCAGTATGTCCAAATATTGATAATACCTAAATTTCACAGT
TCAATCCTACAATAGAAATATACATATGTGGAAAGATATATTTAATGAGTGGTCAATAAA
ACTAAATATTTATTTATTTTGAAAGTCAGAGTTACAGAAAGTGATGGAGACACAGAGAAA
CACAGATCATCCATCTGCTGGTTCACTCTCCAGATGGCTATGATGGCCAGCACTGGGCCA
GGCCAAAATAAATGATTTTTGGTCAATACAAGGTATAGGTTGTCATCATTTCATGAAAAA
CCATAAATGCCTTTGAGAAAATTATGTCATATATGAAGATGCATGTGTTTGGGCAATGCC
ATTCTTGGCTTAAGTATCAGCTTTTTCAATTTACATAATTTTGCTGAGTTGAGGGACATT
CAATAAATATCAATATTGTTATTAACTAAAATTCCATGGAATTTTTTTGAAAATATAAAT
ACTTTAGTGTGTATTAAACTATTCGGTAAATATTTATTAAGCTACTTTGTGCCAGGCAAT
CTTTCAGGCAATGAAAGACCAAACAAAGCACCAGCTGTCTAAAAGGGATGACTATATTAT
ATGGCAGGTAAAGAAAGTCTAAATGAGGAAGATAAAATTAGAATAATGTAATAGCAAAAT
GTTCTCATGGTATTATATATATAGGCTACCTAAGAAAGATCTCCGAGGTTATGTTAGGGC
ACAAAAGTGAGTAAAGTGAGGGAAGAAGCTATGCAAAAGGAACAGAAAATACGAAGGCCA
TAGTGCCTAAGTGCGAAAGCCCAGTGCTTAGAAAAGCAATGGGAACAGAACAGTGTAAGT
AAGGAATACAGTGGTAGGAAACGAGGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved