Oryctolagus_cuniculus Locus Mono:21:SNORA75
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:21:SNORA75
Oryctolagus_cuniculus
Mono:21:SNORA75
scaffold_189439
SNORA75
1001..1131
2131
GCCCGCAAAGGAACGACGTTGCTCGCAGCTTATCGGTCTTCAGTAGCTTTTATTGAGAA
AATAACAGTGACAGAGAAAGCATGAAAGGAGGAAGAGAGGAGAGAGAAAAAAGCCCCCTC
CTTTCTGAACACACAGCTTATATACAAAATTCAACCAATCGCAAGCGGGCTCTAGTCCAT
GCATGGAACACTCCAATCCGCTGCTTGTTCACGCGGTGTGCACGCGTCCTCGGGCCAATC
AGATGAAGTGTCATGCAGCAGGCAGGCTCACTGCACAGTCCTCGGCACCATCTTGTTGTT
TACGAGACAGGCTCAACTTCTCTGGAAAGTCCCGACCGCTGGAAAGCATTGCCCTAACCG
AAACTAGCAACATCCGCCTTGCAATAAAGACACAACGACAGCTTTCAGACCAAACCCTGA
CATGGGGACCCCATGGCTGGCCAGCTCATGGGGCCCCACAAAAAAACCCACCCAGTAAAT
ATACATTCCTCCTCCCTCCTTCTGCCAAAGTTCTATGAAGTTGATAAACAGAGTGATCTA
GGAGAGAAAAATGTAGGGGGCGGAGGTAACCTACTTCCCTGTGGTCAACATGGAAATTTG
ACAACAAAGCTCAAAATGTAGCTAAATAAAGAAAGAGAAAGGAGTTAGCTCTGCATAGAA
TTGGATGCAGAGCATTTCTGTCATTGGAAAAAGCACATGTACATTCATAATGCAAGAAAG
GTCTTAAAATGTCTGGGAGATAAAAGTAACTGAGCGGGAAAGTGGCTCAAAGTGAGATTG
AGGACCAGGTTGTCACGGGCCTAGAGTATGCTGGCTGGCATTTGAGTGCAGTGGGAAGGC
ACATTTTAAGATAATGGAATACGATCTAGTCTATTTTTTAAGAAAAGTGAAAGGGTTCTG
AATGTTATATAAATACTTGGTGGAGATTTAATTCCAGTAACGTTGGAGACTGAGCTAATG
TAGACTAATTTCTGGTTACACATTCATAAACTGTTGAAGATGTCTTCTCACTGAGCTCCT
TTCTATTGATTGGTGGCATTTATGGATTTGCATGAGACAAGAAATTCACAGAATTAGCAT
TATTTTACCTTCTGTCTTTACAGTGTATATGTGATGGTTTTGTGAGACATTTAGGAAAAA
ACAAGAATACTGGAGATTCTTAATGCTACACAAACAAAAAAACAACAAATAAGTAACACA
GCTGGATAAAGGTAATTTTTCATGTAAAGTAGGACCCATAATCCTAAACTAGAGCTGTAT
TTATGGGTCCAATGCCATAGTTCTGCAAGATACTGGATTTGGCTTTAGGCTTCAGTGTTC
AGGCCCTGGCATTGCTGATTTTCTTTTTCTTTTTTCTTTTTTTCTTAAGTTTTATTTATT
TGTTTGAAAGTCAGAGTTAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGGCGAGAGAGGAT
GACACACACAGAGAGATCTCTCATCCAGTGGTTTACTCCCAAGATGGTCCAATCGCCAGG
GTTGAACTAGTCAAAAGCCTAAAGGAGCTTCGTCTGGGTCTTGCATGTGTGTGGGAGGGA
ACCACACACTTAGACAATCTACTGCTGCTTTTCCCAGGCCATTAGCAGGAGCTGGGTTAG
AAGTGGAGCAGCCAGGATACGAACCAGAGCCCACATGAGATGCCATCATCACAGGCAGTG
GCATTACCCACTAAGCCACAGGGCTGGCCCCTACACTTTTTTTTTTTTTTTTTTTTGAGA
GGTACGGAGACAAAGAAAGAATGTTCCCATTTGTTCTCAGATCTTTAAACTCTCTTTGAA
CTACAGATTTTCTGCCTTAGTTTCCACGGCTCTAACAAAATACCATAAACTGAGTGACTT
AGAATAAACAAGAGAAATTTATGTCTCACAGTTCTGGAGGATAGGAAGGCTGAGGCAAGG
CACTGGCAGATTCAGTATCTGTCCAGGGCCAATTCCTGACTCACGGATAGAGCCTCTTAC
TGTGTCCTTATCTTGCTGAAGGGACTAATTGTCACTCTGTGGACTTCATAAGAGTACTAA
TCTCAATCATGTTATCATCAATCCAAAAGCAAACTTCCAAATGTCATCATTTTTGGAATT
AGGATTTCAACATATGAATTTAGGAAGAACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved