Oryctolagus_cuniculus Locus Mono:109:SNORD61
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:109:SNORD61
Oryctolagus_cuniculus
Mono:109:SNORD61
scaffold_211710
SNORD61
1001..1070
2070
ATATTTATTTGTCGCCCTTTCTTTCAGCACTTTTGGTAATCTTGAGCTGTACAGAAAGA
CATGAGACATACAAAAAGAACTGTTGCAGAAGAAAATTTGTTTCTTATATTTCAACTAAA
GTGACTAGATAAAGTCACAATTAAAACAAACTCTCTCAGCCGGTGCCATGGCTCACTAGG
CTAATCCTCTGCCTTGCGGCGCCAGCACACAGGGTTCTAGTCCCGGTCGGGGCACCGGAT
TCTGTCCCGGTTGCCCTTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGA
GGATGGCCCAAGTACTTAGGCCCTGCACACCATGGGAGACCAGGATAAGCACCTGGCTCC
TGCCATTGGATCAGCGCGGTGCGCCGGCTGCAGCGCACTGGCCGCGGCAGCCATTGGAGG
GTGAACCAACGGCAAAGGAAGACCTTTCTCTCTCTCTCTCTCTCACTGTCCACTCTGCCT
GTCCAAAAAAAAAAAAATAATAATAAGTTTTTAAATCAACAATATATTAGTTTAACAAAG
TAATTAGAAAGAAGGCAGTTAAGAATTGATATTAAAAATACCATTTACAATGATGTTCAC
AAAGTAAAATATCTTGGAAAGAAGTCACAGGAAATTTAAATTTTCATGAGGTAGAAAACT
CAATTTATCTGTAAGTTTGATGCCACCTTATTAAAACTCTCAAGAAATTTCTGTATGTGA
TTTAACAAACTAATTCTCAATGTATATGAAAGAAAAGGATTAGTTAGATACCATTAAAAA
GAAAAATACTGGAGAACTTGCACAACTAGTTGTGATTTTAAGGATACAGTAAATAAGTCA
ATGCATCATTGGTGAAAGAAAATACAGATTAATTCAATGGATTAGAGATCTGTGCATATA
TTTCTGAAAAAGGTAATAAAAGAAACAAAAAATCAAGGAAAAGGAAAAAATGTGACTGAG
ACAACACGATAGTCAAATAGACAAAAAATGTTGATTTTCAAGCTATGATGAATTTTATTG
CATTGATCATCTGACATGACAATGTATTTTTTCCTCTAAATTTTTGAGGTTTAAAAAACA
TTTTTTAAAAAGCATACTGAATTTCACTCCTGCTCAAGTTCTATGTAAAATCAAGGGCAG
GTGTTTGATGCAGAGATAGGATGCCACGTGGAATGCCTACATTCCATATCAGAAAGCCTG
AGTGTGAGTCCCAGCTCCACTCCTGACCCAGTTTCCTTCTACTGCACACTGTGGGATGCA
GCAGGTGATTTCTAAAGCCACGAAGACCCAGACTGAGTTCTAGGCTCCTAGCTTTGACCC
AACCCAACTCCAAATGTTGCCAGCATTAGGGGAGTGAACCAGAGAATGTCAAGTATCTTT
ATCTGTCTGCCTTTCAAATAAAAATGAAAATAAATAAATAAAAAGTAAGATCAAGATGGA
GCATAGAACCAAATACAAAGGGGAATCCACAAAGCATCCTTCACTGCAGGGAACTCATTC
TTAAACAGCTCACACAAAAATTCATTAATCATGAAGATAAATATTGTTAAATGAGGCTAC
AGTGAGAGTATAACTTTTTATTATAAAATACACCCACTAAAGGATGACAAACAAACTTCA
GAATGGGAAAAGATATTTATAATACATTACAAGTTTAGCTCTACANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAATATTGTGATATAA
TATGAAGTACATTTAGTCTCCACTCTTCATTCCTGACTTATAGCTTTAGAAACCCTATGG
ATAGGGGACAATCTTTCATTCTACCACCTGGGCTTCGGACTCTCTTTTTCTAATATTTAT
TTATTTTACTTGAAAGAGTTACAGAGAGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved