Oryctolagus_cuniculus Locus Mono:242:SNORD70
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:242:SNORD70
Oryctolagus_cuniculus
Mono:242:SNORD70
GeneScaffold_5950
SNORD70
1001..1089
2089
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTTCTTCCAGATCTCCCATGTTGGTAACAGGAGCGCAAGCTCTGAGGCCATCCTCTGCT
GCCTCCCCCAGGCACATTTGCAGGGAGCTGGATCAGAAGCAAAGGAGCCAGGCTTCAACT
AGCACCGATGACATTGCGGGCTGTGACTTAAGCTGTAGAGCCACTCCACTGGCCTCAGTT
TTCCTTTTGAAAGTGTTATGTGCTTTCCTGGGTTATTTTGATTCATCGTTGTCAATGATG
TATTCTTGTTGGAACTGAATCCAAATGATCTAACTCAGATATTCGTCACTACCACTGAGA
CAGCGATGAATTAGCTATGCAAAATGTTGCTCTGCGCTTAAGTGTATCAGGAATAAAAGG
TGCTAAATGTGGGTAACAGGAATCATATCTGACAATAAGCTTTTTTTTTTTAAGGCTTTA
TTTATTTATTTGAAAGGCAGAGTTACACAGATAAAAGGAGGAGCAGAGAGAGAGAGAGAG
AGGTTGATCTTCCATCAGCTGGTTCACTCCCCAATTGGCTACAACGGCCAGAGCTGTGCC
AATCTGAAGCCAGGAGCCAGGAGCTTCTTCCAGGTTTCCCACGTGTGTACAGGGGCCCAA
GGATTTAGGCCATCTTCCACTGTTTTCCCAGGCCACAGCAGAGAGCTGGATTGGAAGTGG
AGCAGCCGCAACTTGAACCTGCGCCCATATGAGTTAGTGGCACTGCAGGCGGCGGCTTTA
ACCGCTTTGCCACAGCGCCGGCCCCAATAAGCTTATTTTTAAAAATGACATTTGTATTGG
GTAGAAAGTGAATGCCAGGGGCTGCCAGTGTGGCATAGCTGGTAAAGCTATCATCTGTGA
TGCTGACAGCCCTTTTGGGTGTTTTCCTGAATGCTTCACTTCCAGTCCAGTTCTCTGCTA
ATGGCCTGGGAAAAGTAGCAGAAGATGGCCCAAGTGGTTGGTTCCCTGCCTACATGGGAG
ACCTGAAAGAAGCTCGTAGCTCCTGGCTTTGGCTTGGCCCAGCCCTGGCCATTGCAGCCA
TCTGGGGAGTTAATCAGTAGATCTCTCTTTGTTTCTCCCTCTCTCTTTCAAATAAGTAAA
TTTTAAAAATAGGACATGGTATTTAAAAAAAAGAAAGAAAGTGAATGCCATGAGATTCCT
AACCTCAGGGGCTTAAGTAATTTTTCTTGGGTGAATTTTATGTTATATTTTAAAACTCAT
CTATATCCTCTTTACCATTGGCCTAAGTTACCCTCAAAGCCTGCAACTTTATGCTTCTTG
AAGCATTAGTAGCCCAACATTTGGAAAATCTGGTCATTTCATGAAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved