Oryctolagus_cuniculus Locus Mono:243:U8
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:243:U8
Oryctolagus_cuniculus
Mono:243:U8
GeneScaffold_5816
U8
1001..1135
2135
GCTGTTGTGGCCAGACTTTCTTGACTCTGTGTGTCGACACGAGCATCGGAGCGCACTGT
AGTGCATCTGTAGCCCTGTCGTTCTTCATATTCGAGCGCTGGGAGTGCACCACGTACTGG
TACATTTTTGTGTTCTGCAGGTGCGGTTAGCACCCAGTCTCGGGGGTGGGGAGGAAGGCT
CGCCCCATCCAGCTCTTCCCTGAATGTTTGAGACACCAAGACCACATCCTGTGGTCCTTT
GAAGTCCCCCCTCCAATCCCACCCTCTACACTTCGGGGCTGGGATGTCTGGTTTGGAGAT
TCGGGTATTTATGTTGGAAGGGGGCCTGACCCCACCACCTGCCTTCCACAGCGCCCTCCC
AGCTGTCACTGAAGTGGCATTATTCATCGCCGTCTTTGGGCTGAAAAAGAAACCCTTCTG
ATCATCCTCACTGCAAGAACGTGGAGAACAGGGCTGGGGGAGCCAGAAGCTCCCGTTCCT
GGCAGGACAGCGTCGCCGCACCCCGGAAACTGCTTCTGGTGGAGGATGTCGGTGTTGGGA
TAATTGTCTGGGATTATCAGCGTTTTAGTCAGTGCTTTGTAATAAATAAAATCTATTTTA
TAATAAGATCAAAATTTATACAATTTTCAGGGAACAATTGAGTTGGCCAAACTACTGCAG
AGAGACTGCTTTCCAGCCCATAGAACAACAAGGGTCGCTTCTATTTGGGGTATTACGGTA
GACAGCTGGCGGCAGGGAAGGGCGGAAGATATGCAAATAAGATTGTGTATGCTCAGAACT
CCCGAGCACGTGAGGGAGCAGAGCATTCTGAGAGGAGTTAGTTTATTCCTTTTTGGCAAT
TGAATTTAAAAAGTTTTTTTTTTAACGTTACAAATAAATGTCGAAATATGATTGAAATAA
TTCAAAGCAACTGGGTTTCTCCGACTAACGCGTTGCGTATTCACCCTAGGTCTTAGGGGC
ATCTGCTCCTCCGAATGCGGAATGGCCGGGGCGGGCCGGTATCGTCAGGTGGGATAATCC
TTACCTGTTCCTCCTTTTGGAGGGCAGATAGAACATGATGATTGGAGTTCGCATGATGCG
TGATTAGCGTCTCTGCGTAATCAGGACTTGCAACACCCTGATTGCTCCTATCTGATTCTT
CCTGACGATCGCCTCCATCTTTTTGGTTTGTGCTGAACGATAGATGTGGGTTGTGGGAGA
GTTGTTTTGGCTTGGGGTACACTGGTTTGTGTTCTGGTAGATAGGAGTTTCATTTCTTCC
TGAGAATGTTTTCCTGCGGGTACTGTGTTTTTCCGTGCGCCTGTGTGATTCCTGTCCCTG
GTGGTCTACTTTCTCCCCTTGGCCCACATTGGAAACCCTGGAGAAACCAAAATTTTAGCT
AATTGCCCTGAGTAGAGGACATCTTTTGATTCCCTGTGAAATGGTGGTTCCTATCAGCCA
CCCTGGGTGTCACAAGTGTTTTACTTAATGGTCCTGGCGAGAAGGGTGGACTCCTCTGGT
GGGTACCCCACCTGAAAACCTGACAATGCACCCCTGTTCAGTCTTGTCTGATGAGACCAC
CTCCTGAAGAAAGCTGTTAAAACGCATTGACACAATAGGACACTGTACAGATAGGCGAGT
TTACAAGAGTCTACAGTTCTGTCATATAAATATTCTCAGGGTTCTGTGTAAGCTGGGAAG
GTTTCTCTGTAGGTTTTTTAACCCAGAGTGGTGGAGTCCAAGCTGTTCCAAATAACCGAA
AAGCGTCTGGTGTTGCCTTTCAGGTGCTGCCTCACACACATAACCTTTCCTTCTGCCCCC
TGGCACTGCAGCCCTTCATCCATAACATTCATTCAGTGAGTGCTAATTGAGCACACACTG
AATGCAGAAAGCCCTGAGCCCTGACCCCTACTCAGTCGACCCTGCTGTGGAACAGGGGTT
ACTTTGCTCAAGGAGGCAGGAGTGGTGTCACTTCCATGAGAGCGTGACCGGAGCAGAGAG
GAGTAGGAGACTTGATCTGGAGGGTTCCGTCCCGTCACAGTCTGCCTCTCAGTCCCACCC
AGTGCAGTGCTCCAACCACCTTGGGGGAAATGACTGTTCTTCAGTAACTTTCTGAGCCAG
GTGATAAACACAGACATTATTAAAATTTAATTATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved