Oryctolagus_cuniculus Locus Mono:22:SNORD32
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:22:SNORD32
Oryctolagus_cuniculus
Mono:22:SNORD32
scaffold_191828
SNORD32
1001..1083
2083
GGGTCAGAGGCCTCAGCTCAGGGCCTACATCTGTCACTTACCGTGTGACCTCAGCCAAA
TTAGCCATTAACAAAAACACAAGTTCACATTAGAGAGCTTATTAAACAACAGGCCAGCTT
ATGCACCTACATTCATTGCCTCGTATAATCAATTCCTCCAACAACCATGCCAGAGAGGTA
GTATTATTATGCCTGTCTTGCAGGTGTTATAATGGAAGCTTTGAAAGTTAGCTCATTTAT
TCAACACACAGGTGCTGTGAGAGGCCAACCCTGACTTCTGGGGACAGAGAGTGGGCAGAG
ATCAAGCCACAAACCCCTGCACCAGATCATTTCTGAAAGCAGAACACACTGTTCAGGTAC
TAAGGCAGGGCGGTGTGATGGACGGTGACTGGTATGAAGAGGGGACCCGGGAAGGCTCAT
CAAAGGACGACACGTTAGCTTGAGGCATAGAGGCTTGAACATCCTTGAGCATAGCCATGC
AATGACTCATGGGGCAGTGCTCCAGAGGAGTGGGAACTGTGAGTGTCAATGCCCTGACAT
CTAGTAAGTGCGGTGTGGCTGCAGCAGGCTGGGCCAAGAAGAAAGCTATCGTGAGGCTGA
GAGGGGACAGGGCGAGCTCCCACCCTGCGGGTCATGGTGCCAAGTGCTATGTCAGGTGAT
GGGAATCACCGGAGGGCTTCAAACAAGGGAAGGACTTGGATGAGTCTACACCTTTAAAGA
CCTCTTTGCTGTGTGGAGAACAGGTTGTCAGGCTGGGGGCTTGGTCAGGAGACTGACTTA
GCTGCACCAGCAAGATGACGCTGAAGGCTGGCGTAGGCTGACGGTAATGGGCACGCGGAC
AAGCGGATGGACCCACAAGGTGTTTGCAGAGCAGACTGCCGAGATTTGAGGATGGATTGG
ATATGCAAGGTTAGGAAGCAAGAAGGCTCAGGACAAGTCTTAGTTGTTGGTGACGTTTGT
TGGGATGAGAGACTGAGCGAGGAACAGTTAAGGGTGGGATGGTGCCCATGATGAGCTACA
ATCACCAGCTTTGGGCTGAGTCTCACAACCATGAGATCAAACCCATGTAACTGCTCTGAG
ACCTGCCAGCCATTCCCTCCCCGAAGCGGGGGGACTCCCAGCTCAGATGTGGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved