Oryctolagus_cuniculus Locus Mono:38:SNORA29
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:38:SNORA29
Oryctolagus_cuniculus
Mono:38:SNORA29
scaffold_203050
SNORA29
1001..1139
2139
AAAAAAAAAAAAAAAGCTTTCCACTGAGCAATTTAATTGACCTAAGTTTTCATATTTCA
TATTTCAAGTTCTGCATATTTCATAGTGAGCCACATCTTACCCATTGTTTCGTATTGCAT
TTAGGGTCCTTGCCTACAGGACTGAACAATCATTCCTATTAAATTCCTTTTGATTTAGGT
TCAGTATGATATTCAGAATGTTTCCTTGGACCTTGATTCTGTTATCCAGAGTACTATTAG
TGTCCGACCAGATTCCAACTACAAATCTGATCAGCAAGTCACATAGGTGTTCCTTCACTC
TCTGCTCAAAGTACAGACAGGAAAATGAAGACACAGCACTGGAACTTTCCAACTAAAGCC
AGCCATCAGACTGTATTCTGTGCGCAGTTATTCCAACAACCAGGAGGCCACCCAGCTGCA
CTACCACCACCAAGGGTGTCTACAGATTTCCTGGTCTCCAGACTATATACTATATATACT
ATACTATACTATATACTATACTATACTATATTCTATACTGCTCCCCCACTGCCTCCCCTC
CATTTAAATGCCTGAATTACAACCCAAGACAGGATGGGGCCTGCAGTAACAAACAAAGAC
TTAGGATCAATCTGAGCATCTCTTTTACTAATAATCTTACTAATAACCTTATTCACAATG
CTGAACCCCTCAAATCATCACAAAAGATTTGATTGATTTAAGACTTGAAATTAAAGTTGC
ATCATTTAGAAACATCTTTACTACATCACTAACAGGTTTCTATGAATAAAAGTCTTCTAC
CAATATGAGATCTGTGATCTTTAGTTTTATCTACATGATTTATTCACAAGATAGCCTAAA
GAATTTAGACTTACAGTATCCTATTTTTAGAATTAGTTTCAGAACCTGTGAACTTCAACT
ATTTGACAAATTACCAATGTATTTAACAAATGAAAAGTTTACCAATGTCTGCATTTTAAA
AATATACACTTTCTATCTTCAAAGAGGAGTTATAATATATATTTCTCATCTGACTACCAC
ATTTTCTCCAGTTAATAGATTTTAGTGGCTATGCTTATGGGATAGATTAAAATTGCCAAG
ATCTGAAGAGGGTGTGGTTTTGGTACCCCCTTTCTTTATGAAATGGCTAAACAGAAAAAA
AGTATAACTTATTTTTTCTTCTGGTTATTCACTTTGCCAAAAGGTTGTGCAAGCATGGCG
AGCATCACTGTCTTACCCATGTTTTGGTAAATAAGAAAAGCAAACAGCCAATCCTGCTTT
TAAAAAAATAGTCCCTTAAAAATAATGCCTTATTCAATTCAATCCTTGAACTGTAAACAA
ATAAGAAAATTTGAAACAAAATTCAAATACAGAAAAAGTCTTTTAGAAAATTATTTCGGC
CGGCGCCACAGCTCAATAGGCTAATCCTCTGCCTAGCGGCGCTGGCACACTGGGTTCTAG
TCCCGGTCGGGGCACCGGAGTCTGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTG
TGGCCCGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGACCCTGCACCCCATGGGAGAC
CAGGAGAAGCACCTGGCTCCTGGCTCCTGCCTTCGGATAGGCGCCGGCCGCGGCGGCCAT
TGGAGGGTGAACCAACGGCAAAAGGAAGACCTTTCTCTCTCTCTCTCTCTGTCTCTCTCT
CTCACTGTCCACTCTGCCTGTTTAAAAAAATATTATTTCGGTTTTAGAGAGTAAAGGCAA
ATTTAAGATGCTATGGTTCTAAAACGCTACACCTGAGAGTGGTGAAATGATTTTTATTTT
TTCCTTTTAGTCATGTTGATGAAGACCTGTGTTTGTTTGTTTTTTACAGAGAGTTAGACA
ATGAGAGAGAAAGGTCTTCTTTCCGTTGGTTCACCCCCCAAATGGCTGCTACAGGCGGTG
CTGTGCTGATCTGAAGCCAGGAGCCAGGTGTCTTCTCTTGGTCTCCAGTGTGGGTGCAGG
GCCCAAGCAGTTGGACCATCCTCCACTTGCCCTCCGCGGGGCCACAGCAGAGAGCTGGAC
TGGAAGAAGGAGCCACCCAGGGACAGATTCCGGTGCCCCGACCAGGACTAGAACCCGGCG
TTCCGGCACCCGCAGGCGGAGGATTAGCCTAATGAGCCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved