Oryctolagus_cuniculus Locus Mono:56:SNORA9
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:56:SNORA9
Oryctolagus_cuniculus
Mono:56:SNORA9
scaffold_92180
SNORA9
1001..1130
2130
TGCACCCGCATGGGAGACCAGGAGGAAGCACCTGGCTCCTGGCTTCAGATCTGCGCAGC
ACACTGGCCATGGCGGCCATTTGGGGGGTGAACCAACGGAGGGAAGACCTTTCTCTCTGT
CTCTCTCTCACTGTCTAACTCTGCCTGTCAAAAAAAAATTAAAAAAAAAATACTACAGAT
GATGGAACAAGGACATAAGCCTCAGCCATTCTCCCTCATTGTCCAAAAGAGATAAACTCT
GGAATGTATTCCTTGCCCTTGAAACTCAATTGGGTCTCACACCCTATTGCCTTTAGACCC
CACCCTGCATTTTTTTTCCAGGTCCCCAAGGCCTCACTCAGTTCCAGGAAATCCCCTCCT
CCTGCTGCTCCCTACCCACACCTCCAGCCCTAGCCTTCCTTAAAAAGGCTTGACCCCTGG
GAGTCAAGGCCTTCTGCCTCATGCTCCATCATGTTCATGTAGGCATTTGGTCACCCAACT
CTACAGTCTGGCTGTAAATTCGTACACCGCCTCCTCTCTATTCTGTGCCTCTTTTCCTAA
CATTTTGGTGCCCCATGTGAGGAGGAGACATATCAATTGGTTGAATTAAAGTGGAGTAAA
GTTAAATTATAAGTTGAATTAAAGTTCTTCTCTGTAGGTGTCAAAACTGTTTTACTCAGA
TCAGTTGCAGATAAGAGCAGAGGTTCCAATGAAAATTTTAAACAAATGGGATTGAAATTC
TGAAGTAGTTCTTTGAAAAGTTGTAGCAGGAGATAAAACATGGCTTTACTGGTACAATCC
TGAAGACAAAGCATGATCAGTGCAATGGCTACCGAGAGGTGAAATGGTCCAGTCAAAGCA
AAGGTTAGTCAAGAGCAAAGGGCATGGCAACAGTTTTTGGGTGGGATACTCAAGGATCTT
TGCTTGTAGAGTTTCTGGAGGGCCAAAGACTGATAGTATCTGCTTATTAGGAAAAAAGTT
TTGAGAAAATTAAATTAAGCTTTGACATAAAAATGCTGGGAAAGCTACCTCAGGAGTTCT
CCACCCTGCTGTGACCCCGTGCACCCTACAGTGCTGGCCAGGACAGTTTTGAATGATTTG
AAGCCTTGCCCTGCTCAATCCATAGCAAGGTTGTAGACATTTCAGACAGTTGGGGGGGAA
AAAGAGTCCTCCAAGACAATGCTTCTGCTCATTCCTTTCTCTTATCAAGCAGTGGCAATT
TTTTGAGAGTTTTAATTATAAATCATTAGGCATCCACCTAACAGTCTTGACTTGGCTCTT
CCTGACTTCTTTTTATTTCCTAATCTTTGAAAAACTTTTTGGGGCTTGTATTGTGGCACA
GTGGGTTAAATACCACCTATGACACTGGCATCCCATGTTGGAGCACTGATTTGCATCCTG
GCCTCTTCATTTCCAATCTAGATCCCTGCTAGTGGGCATGAGAAAGCAATGGAGGATGGC
CCAATTACTTGGGCCCCTGCCACCCACGTGGGGGTCCTGAATGGAGTTTCAGGTTCTTGT
GTTCATGCTACCACAGCCACAGGTATAGTGACCATTTGGGGAGTGAACTAGCAAATGGAA
GATCTCTTTCTCAATCTGTCACTCTATCTTTCAAATAAATAAAACAAATCTTTTTTTAAT
TATTTAAAACAATATTTACAGGCCAGCGCTTTGACAAAGTGGATTAACACCCTGACCTGA
AGCACCGGCATCCCATATGGGTGCTAGTTCCAGACCTGGCTGTTCCACTTCCAGCCCAGC
TCTCTGCTATGGCCTGGGAAAGCAATGAAAGTTGGTCCAGGTCCTTGGGCCCCTGCACCT
GCGTGGGTGCACCCCCCCTTTAAATAAGTACAATAAAGAAATTAAAGAATTACAAAAAGA
ACTTCAAAGAGGGGATACATTTTAAAAAGGGTCTGCTTTGAAAAAAGGGCTTCTAGTAAA
GATTAGATTAGGAGGCCCACCCCACGGCTCACCAGGTTAATCCTCTGCCTGTGGCACCAG
TACTCCAGGTTCTAGTCCTGTTTGGGGCATCTGTTCTGTCCCAATTGCTCCTCTTCCAGT
CCAGCTCTCTGCTGTGGCCCTGGAGGACAGTGGAGGATGGTCCAAGTACTTGAGCCCTGC
ACCTGCATGGGAGACCAGGAGGAAGCACCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved