Oryctolagus_cuniculus Locus Mono:134:SNORA29
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:134:SNORA29
Oryctolagus_cuniculus
Mono:134:SNORA29
scaffold_175487
SNORA29
1001..1137
2137
CAGGCCATAGCAGAGAGCCAGACTGGAAGAGGAGCAGCCAGGATTTGAACCGGCTTGAA
CAGATGCCCATATGCGTTGTTGGTGCTGCAGACGAAGGCTTAACCTACTACACTACAGTG
CTGGCCCCTCATTTTACTTTTAAAAAAGGCAAGGGTGGAGACACTAGTCACTATGGAATG
TGCTGCACGCTTTGTATACGCCCTTTCCTGCTAAGATACATGCAAAATTGCCTAGGACAA
GTTCCAGAAAGAAAAATGGTGCTCTTCGTATCTGAAGGAAAGGTACAAATCATGCATGCA
TATGTTGGTAATGCTTCCCTACATACGGTTTTGTGAATCCAAGATATTGCATGCTGTTCC
TGAAGATACCACAATTGAAACCAGAAGGAGGAGAGTAGGATTAAAAAGCGAAACAGGCAG
GGGACTAAGTAATTAATGATGTTAAAAATACTGACAGAAAACTATATCCACAAGCGCAAA
GGTGCCGCTGTGCTAGGGCGGCAGCATTAAGAGTGATTTTATTTTATATCCTCTTGTTTT
CAAATGCTCCTAAGTGGGCTTATGCTGCTTTCAGAGTTTTCAGTTAAAGGTTAAAGCAGT
CCGGGGAAAAAACAGACATGTTAAGCCCAAAGAGAAACACTGAAATTGCTAGCCTAACAG
GACCAATCCTTGACGCCAAAGACAAGAAATAGGATGATCTCATCAAAGTGCTGGTGGTCG
AAACAGAATTTCTTAAAAAGTAATCTAGAACTTGATACTCCACAAAATATCTTTCAAAAA
TGAAGGTGACTACCCCCCATAAAGATGCCAAATTGATGTTTATCGAGAATACAAAAGCAA
TTCAATGGAGAAAGATAGCTTTTTCATAAAATGGTGCTAGAAACAATTGGTTGGGTAGAG
GCAAAAAAAAAAAAAAAAAAAGAAAGAAAAAAGAAAAGAACAGAACCTTAATCGAAACCT
CACTTTATACAAAAATGTAATTCAAAATCAAATCAACTCTTTTTCCCATTTGACTACCAC
ATTTTCTCCAATTAATACCTTTTAGTGGCTATGCTTATGGGATAGGTTAAAATTGCCATG
ATCTGAAGAGGGAGGGACTTTTGGTACCCTTCTATATGAAAAAGCTGGACAAAAAAAAAA
AAAAAAAAAAAAAAAGAAATCAGCTCTTTCAGATTACAGATATGAGTGACACCATGTGGT
ATTTGTGCTTAACTGCCTGGCTTATTGCACTTAACATAATGTGGTCCAAATTCATCCACG
TTCCACATCACAAATGCCAAGATTTCCTTTTCGAGGTCAAAGTTCTGGTGCAGCGGGTTA
AGCTTCTGCTTGTGATACTGACATCCCATATCGAAGTACCCAGGATTGAGCATCACCTCC
TCTTCTGATCCAGCTCCCTGCTAATGCACCTGGGAAAGCAGTGGAAGATGCCCCAAGTGC
TTGGGCCCCTGCACCCATGGGAGAGATCCAGATGGAGTTCCTGGCTCCTGGCTTGGCCTG
GTCCTTTGGGAAATGAACCTGTGGGTGAAAGATCTCTTTCATCTCTCTCTCTCTCTCTCA
TGCTCTGCCTTTCAAATATATATGCATATATAAATCTTTAAAAATAGATTTCCTTCTTTT
TCTGGCTAAACAGAGAACAGCATTCCATTGTGTATATGTACAATATATATTTTTTAAAGA
TTTATTTATTTTATTTGAAAGAGTTACAGAGAGTCAGAGTCGGCGTGGGGGGGGGGGTCC
TTCCATTTGCTGGTTCACTCCCCAGTTGGCCAAAATGACCGGAGCTGGGCTGATCTGAAG
CCAGGAGCCAGGAGCCTACTCCACATCTCCCACGTGGGTGCAGGAGCCCAAGGACTTGGG
CCATCTTCTACTGCTTTCCCAGGCCTTATCAGAGAGCTGGATTGGAAGAGGAGCAGCCAA
GACTAGAACTGCCGCTTCTATGGGATGCTGGCGCTTCAGGCGGCAACTTTACCTGCCACA
GTGCCGGCCCTTTTTTGTTGTTATTGTTTTTAAACATTTGCAATATTTTTAAGCCATTCA
TTTATTAATGAGCACCTTGGTTGATTCCACATCTGGGCTATTGTAAATACTGCTGCAATG
AACATGTGCAGATGTTTTGTAGACATGCAGCTTTCATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved