Oryctolagus_cuniculus Locus Poly:15:SNORD115
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:15:SNORD115
Oryctolagus_cuniculus
Poly:15:SNORD115
scaffold_185821
SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2741..2821, 4576..4656, 6394..6474
7474
ATTAGTGCAGATCGCATCCAAGAAGATATTGGTATGAAGAGAATAATTACCCTTATAGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAGCTCGCCAGGGTCAGTGGGGACAGTGAGAGGGTT
GAGGGAGCACACAAGGAAGGAGTTTGCCCTTAACCAGCTGTTGCTATCTGTTCATACCTG
TCCCCCTTCCTGTCCCACAGATAATGTCACTAGAGGAAGCCCCCGTGGGTTCCACTGATT
TGGGGCTAAAGGGAATGGTCAAGTCCCCAGCAGTCCATGAGCTGGTGCTGCCAACAGTGT
TGGAGAAGGAAACGTCCAGGACTGCCTGTGGTAAGACAATCCATCTGTGCCCTAGAGGTG
AGATGGCATGAGGAAGTAACCTAGGTGTAGTTCCAGAGCTTGGGTTTATGATGAGACCTT
ATACTGTCTTGAAAAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAGCCTAGTGACAGTGGTACAAGAGGACCCTGGCATTTCCACTTGCCTCCCAAGGGAGG
AGACCTTGGGACTGGAGACTTGGAGGCCCCCTAGGCCAGGATACAGTACACAGGCAGGAA
CGCCTGCTAGTGCAGGATATACCCAGGCTCCATCTTCCTTGGGCTTTGCTTTTACTCCCT
GATGGCTGAGATACAGCACTGCCCTTTAGGCTCATTCCTTAGCTCCTTTGTCTCCTGTTT
TTCAGTGAGTTAAGCTGTCCAGTAGCAGGGTTACAAGTAAGTGGATGAAAAGAATCATGA
GGCATGTGCTGGGGAACAGAGTATCTGAGCAGACACTCTGGCAGTTTCCCTGAGCTGTGT
TCCATTGGGCTCTGAGGTCCAGAATGACTTGCCTGGAACCCTGGCCTAATGTAAAGGCTA
AGCAAGGAATGGAAACAGATCCTGGTAGAAGGTTCATGTGAGGCCAGTGCTGCCACTCAG
CCTAGAAGGGACTGACTTACTGTTGTGACCAGAAGTGGGTGGACACTGAGGATCAGACTT
CTGTGGGGGCAACTCTCAGATTCCATAAAAGTCCCAGGCCAAAGACCACACTGTGACACT
GAGGGAGGTTTGCCAAGCCAGCTGGCTTTGCAGGTACATGACAGTCTGGAAGTTTCATGT
AGGTTATAGGGCCAATGGATTCTACCATGCAAGGATGCAGGAGTCAGGTCAAGGGAGATG
ACATCTGGGCCTTAGCACCTGTATAGTGGTGCCCAGCACACCATATCCCCGCTACTTGCC
TCATCCAGAGCTGACTTTCCCTTGCCACATGGATGGGCTATGGACTGAGTTGAGCCCAGC
AAGGGTACCAGTGCCCCTCCTGGGACCAAGTTTCTGCTCCTCCGCAGAGGCACCAAGGCC
CCATGGAAGGAGTGGACCATGGTCCAATCCAATGCCCATACCCTTTGGGATGTGTATGGG
ACTGATGTGAGCAGTGAACATAGGAGGAAGATGTCCCAAACGGGCACACCCTGAGGTCTC
AGGATCCACCGTGTTCATACAACCTTCTCCTGAGCTCCTAGACATATTCAATGACCCCAT
GTGGGTAGGCCAGGACCCCTGGGAGCCTCCTTGGGTATTTCTTGTGGGACTGGAACTCTA
ATGCTTAGGGCCAGGCTGATGCTTGTTTGTCCATTCCAGCTTCCTGTCAGGACTAGGATA
TCAAGTGTAGGAAAGAGTGGTGGGGAGAAGTGCTCTTGTCAGGACAATCCTGCTCAAGTG
TCCCTTTCTGTCCTAGTGACCAAGAGGCCCAGGAGATTGCTGGCAGGATGGGCAGAGACT
ACCTGAGTCCACAACACATAGAGAGGCAGACTCCTGGAAAGCCTCACTAGGCCTACAGGA
CCAACTCATGCACTGGAACCAGTGTACCCTGGTTTCCCATGATGCCTGTTCACACCAACA
CCCTCTCATTCCTATTTCACGGATGATATCAGCAGAGGAAGCCCCCATGTGGTCAAGTAA
CCTATAGGCAAGAGCTGTGGTCAGGGTCCCAGCAGCTCATGAACTGGTGTTGCCAGCCCA
CTGGAGAAGGAAAACTCTGAGATTGCCCAAGGTAAGCCAATACATCCTGGCCCTACAGGT
GGGATGGTTCCAAGGTTTTCCCGTGCTGTGGTTCCTGAGTTGGGTCAGTGATGAGACCTC
ATACTATCTTGAAGAGAGATGATGACTTAAAAATCAAGCTCAATAGGATTACGCTGAGGC
CCAACCTAGTAAAGGTGGTACAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTTCCTTTCATCTCCTTGTGTCTTTCACGTGAAAGGTGCTGCCAGCAGTTCAC
TCTTGGGACCCTGAGCCCAGGTGAGTGGATGGCAAGGATCACTGGCCCTCTGCAAGGGAG
CTGGGTATCAGGGTGGGTCGCTCTCTTAAATCCAGAGTAGTGGACCCATGGGGACACAGG
AAGGCTGCCTCAGGCTGTGCTACTATGTGAGATGTGCCCCCTTTGGGCTCTGAGGTCCAG
AACCCTTTGCCTGAACTCCAGGCCTGGTTCAAGAGCCAACTGAGGGAGGCAGTGGTTCTT
TAGGGAGGGTTCATATGGGCCAATGCCCCCATTTGTCCTAGTTGGGTTGCAGCACCTCTG
TGTTGCCTTGCTGTTGTGGCCATAAAGTGGGATTGGGACTCTGTTGGGAACAGGATTCAG
ATTTGGTAGGAGGCCCGGGCTGAGAACTGCACCAAGGCATTGAGGGAGGTTTGTCAGGGA
AACAGCTCTGCAGGTTCCTGACAGTCTGGGATTTTAAAGTGGGTGGCAAGGCCACTGGAG
GCATAACTAAGAACATTCAGGGGTGCCTAGTCAAGGTGCCTAGTCAAGTCATGCAGGATG
GCACCAAGCATGCCCCATCCTATGTGTTCCTCATCAGGGAATAGCATATGGGGGACACAT
GGGTTGACTTCAAAATGAGTTAAACACAGCAAAAATGTTGGGGCTCCCTACCAGGCCTAG
GGTCCTGCTCCTCTGTTCCTCCATGGGAGGCACCAGGGCCCATGGGAAGAGTGGGCCATG
ATCCAGCTCAATGCCCATACCCAATATTTGGGATATTTATGTTACTGAGGTTGGCAGAGA
CTGTAGCAGAAATATGTGACCTGAGTGCAGAGCCTGAGCGCAAAGGATCAGGTGTCTGCT
GGCAACTTGACCTGAGCGCCCAGGCCTAGAAGGGATGCTATGTTGGTAGGCCTGGGCTCT
ACTGGGGACTCATGTGCACCTCACACCACTGGTCCTCTGATGCCAAGACTGTGCCAGTGC
TTGCATATCCACCCTGGATACTGCACAAGACTGGTACCTCTGGGAAAGGAATGAATTGTA
GGGGTATTTGCTTCTGGCAAGATGACCTGGCCCAACTTGACCTCTCTAAAAAAGTTACCA
ACAGGCTCAACAGTTTGAGGGTGAGGTAGATAGGACTTGTCTGACCCACCATTTCTATAA
GGGTAATTTCCTGGGAATCCTCGCCTAGTGTGATAGGGCAGATCACGCTCTGAAACCAGT
GCACCCTAGCCTGCCCCATCTGTTAGTTCATATCCACAACTCCCTGTCCCACAGATGATG
TCAACAGAGGAAGCACTTGCAGTCCAGTGCACTGGAAGCAAGGGCTGTGCTTCACTACAA
TACAAGCCAGGAGCTGGTGGTGCCAGCCCCACTGGCAAAGGAAAAATCCTTGAAGACCCT
AGGTAAGCCAATCCATAGGAGCCCTTCATGAAGGTGGAACGGCGCATAGGTTTTCCTGTG
CTGTGGTTCTTGTGTTGGGTCGATGATGAGACCTCATATTGTCTTGAAGAGAGGTGATGA
CTTAAAAATCATACTCAGTAGGATTACGCTGAGGCCCAGCCTAGTGACAGTGGTGTGTGA
TGACCCCAGAATTCCCCTGCCATCCAGGGGAAAAGATCCTGGATACTGGAGACCTGGAGG
CCCTCTAGGCCAGGACACAGTCTGCAGGTAGGAGCACCTGCTAGTGCAAGATGTACCCAA
GCTCCATCTTCCTTGGGCTTGATGTATACCCCCAACTGTGGCCTCCTTCCTCAGCTCCTA
TATACCCTTCTGTCTTTCAATGAGAAAAGTAGCCTGGCACCAGAGCCTTTCAACCCAGGT
CACAGGTGAGTGGATGTTGGTGGAATGGGGACTGTGTGGGGCAGCAGGGATTCCTCATGG
GTCTCCTGACACCAACTTCAGAGATGGACCCACGGAGACACAGGAAGGCAGCCTCAGGCA
ATGCCCCTGAGTGAAGTTTGCCCTGAACACCTCTCCTGAACCTTATTGAACCTTTGCCCT
TCAGTGGGTCTCAGGCAAGGAGTGTAAATGCTTCATGAGGGAGGGTGCATGTGGGGTCAG
GCTGCCACTTGGCCTCAGTGGGCCTCAGAATTTCTGGTTTGCCTTACTGGTGTGGCCAGA
AGGTAAAGACCCTGGAGAACCTGACTCTTTGCAGGGGTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGCAGCCTGTACCTGAGCGAGCACCTGGGCCTATATGGCGTCGGTGATG
TTGGTTGCTCAGGGCCCAGTGGGGGCTTCCTTGGGTATGTCTCTTGGAACTGGAATTCTG
ATGCTTAGGCCAGACCATTGCTTGCTTGTCCAGTACAGTTACAGGCCAGAACAAGATTCT
CATGTGCAGGAAGATTTAGTAAGGGAGGCTACTTCCTTCAGATGAATCCTGCTTGATTTT
CCCCACCCATTGTTCCTATGGGGATGGGCTCCCAGAAAACCTCACTTGGGCCAATGGGGC
CAGCATGCTCTGAATCCAGTGACTCCTAACCTGCTCCTCCTGTCTGTTCACACACATTCA
CCTCCCTGTCCCATAGATGTCATACTAAAGAAAGTCCCTATGGGGTCCAGTGCCCCTTAG
GCAAGGATTTGGCCAAGGCCCAGCACCCCATAAGCTGGTGCTGCCAGCCCTGTTGGAGAA
GGCAATGACCAGTACTGCCCATAGTAAGCCAATTCATTCAGAACCAGGAGTTCGGATGGC
TCATTGACCTTCCTGTGTGGTGGTTCCAGGGGTTGGGTCAACAATGAGACCTCATACTGT
CTCAAAGAGAGATGATAACTCAAAAATCATGCTCATTAGCATTATTCTGAGGCCTAGCCT
AGTGAAAGTAGTGAAGAGAACCTGGTAGTAACCAGGTGCCTACCAGGGAATGAGACCCTG
GGCACTAGAGAAACGGAAGTCCCCCAGGCCGGGATGTGATCCACAGGCAGGAGCGACTGG
TCTTTCAGGATGCACCAAAGCTCCATGTTCCGTGGGCTTTGTATGTGCTACCCACTGGCC
AAGTTGGTGGGGACACAGCGGGGCTCCTCCCTCAGCTCCTTTCTGCCCCTCTGTCTTTCA
TAAGTAAGAATAGCCTGGTGAAGCAGCCTGTCAACTTGCATCACAGGTGAGTGGATGGTG
GTGGTAATGGGGCCTATGTAGGGCAGCAGGGCTTCTGTGTAGGTCACCAGACGTGAACCT
CAGGGGTCACCCATGGAGACACAGAAAGACAGCCTTGGACAGTGATCCTGAGTGCCTCTG
GGCTATGAGGTACAAGATGCCTTACATGAACCCTGCCTTGTGTGGGAGCTCAGGAAAGGA
ATCAAAGTGTTTCCTGAAGGAAGTTTCACATGGGGCTAGTGTGTGGCGCAGCTGAAGTGG
GCCTCAGCAGCTCTGGGTTGCCTTGCATGTGTGGCCATAAGTGGGCAGACCTCGGGAACC
AACCTCAGAGAAGGGGAGCAACTTTTAGATTTGGTGGAGGGCCCGAGCTGAAGATCACAC
CAAGGAGGGTGTTTTTGGAAGGGCAGAGATTCTGCAGGTGGCTGTTATCCTGGGAGCTTC
ACGTAGGTTACAGTGTAACTGGAGCCTAGGACATAGTGATGATCAGTCCGGTGTCCATTC
AGGAGGTGTGAATACATGTGCTGCGGCACATTCATGGTGGTGCCAGGCACACGATCCCCC
CTGTTTACCTGGTCCAGGGATGGTGTTCTCAGGCCACATGGGTGGCCTCAGACTAATTGA
ATCCAGCAAGCCCCTCTAGCTCTGGACTCCCATTTCTCCATGGGAGGCACCAAGTTCCCA
CAGTAGGACTGGAGTATGGTCTAACCTAATGCGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved