Oryctolagus_cuniculus Locus Mono:37:SNORA26
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:37:SNORA26
Oryctolagus_cuniculus
Mono:37:SNORA26
scaffold_211927
SNORA26
1001..1100
2100
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCCCACATCCTCCAGAGCACCAGTTCAAGTCCTGGCTCGCTCCGCT
TCAGATTCAGCTCCCTGCTCATGTGTCTGGGAAGGTGGGGGATGATGGCTTAAGTACCTG
GGCTCCTGCCACTCATGTGGGAGACCTGGATGGAGTTCCTGGCTCCTGGCTTTAGCCTGG
CCCATTTGAGGCCATTTGGGGAGTGAACCCATGGATGCAAGATCCTTCTGGCTCTCCTCC
TTTCTCTGATACTCTGCCTTTCAAATAAATAATTTTTTAAAAAGCTGGCAAAAAAAAAAG
TCACAAGCACAACAAAATTCTCAACAAACTCTTGCACTTTTTTCATTGACAATTCCAAGA
TACACTGGGCTTCAACACAATTATTTAAAATTTAAGAATTTTTTCCCTTTTAGAGCTGAG
AGTGTGCTTTAAGAGGCTAACACAGAAGGGGAAAGAAAAGCTCCATAAAACCTAGAGAAG
AGACTGCCTGGAGTCACAGCTGAAAAAATAATTAAGAAGTTCACTTAAATATACATTGAC
TACAAGATCTCACTGCCAGTACTGTAAAGCAGCCCTAGCCTTACCTTTATCAATTGCTCT
AACTTTGCCAAAAGAATCCCACTAAGCAATAAACCTCTGAATAGCCCTAAAGTTGCCATT
TTTGTTGCTGTGTCTTGCTCATAAAAACACAATGTAAATATTTATGAAACTGGTATTTTT
AGCTTTTCCTGTTAAATTCCATCATGGGCATTTCATTGTGAATGAGCCCTTCTGTATGGA
TCACCCTTTCAGCCCTTCGCTATCTGCTACCCACGCAGGGAACCTTTACCGGAGAATCCC
TTCTCTGTTCTGGGCCTCAGTTTCTCTTCGTATGATGAGGGACACAGATTAAAACAATGG
TTCACAGCATGCCTTGTCTTAGAGGCGACAACATTTTGAGAATCTGTTAAAAGCTATGGG
TGACTGCTACATAAAAATGCTTATAAACACTTACATAACAATTTTATACAAAATTATGTA
TAAAGCAAAAGACAGGAATTGACCTAAATGTTCACCAATAGATGGTTAAGTAAATTATAT
CCACATAATGACAGTCCATATAACTGTTAAGAAGAATGGAGAACTGATATGGACTGAAAA
GAAAAGATTTCCATCATGTGCTGTTAAATTGAAAAGGAAAGATGGGGCTGGCGCTGTGGC
ACACTGGGTAAAGCCGCTGCTTGCAGCACTGGCATCTCATATGGTGCTGGTTTGAGTCCC
GGCTGCTCCAGTTCCGATCCAGCTCTCTGCTATGGCCTGAGAAAGCAGTAAAGATGTCCC
AAGTCCTTGAGCCCCTGCACCCATGTGGGAGACCTGCAAGAAGCTCCTGGCTTCTGAATT
GGCAACAGCACCAGCCATTGCGGCCATTTGGGGAAGTGAACCAGCGGATGGACGATGTCT
CTTTCTGTCTCTACCTCTCTATGTACCTCTTTCAGACAAATAAAGTAAATCTAAAAAAAA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved