Oryctolagus_cuniculus Locus Mono:124:SNORD18
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:124:SNORD18
Oryctolagus_cuniculus
Mono:124:SNORD18
scaffold_205689
SNORD18
1001..1071
2071
GATATACAGAAATGATTCAAAATATGTGAATCAATAAATATGACATCACATCAGCAAAA
TGAAGGATAAAAATCGTATGATTATCTCAATAGATGCAGAAAAAGCAATTGGTAAAATAC
AATATTCTTTCATGATAAAAAAAAATCTTTAAAAACTGAGTATAGAAGGAATTTACCACA
ACACAATCAAGGAAATATGTGACAAACCCACAGCCAGCATCATACTGAATGGAGAATGAT
TGGAAGCATTTCTACTAAGATCTGAAACCAGACAAGGATGACCACTCTCACCATTGTTTT
TCACTACAGTTCTAGAAGTTTTAACCAGGGCCATTGGGCAAGAAAAGGAAATCAAAAGAA
TATAAACTGGAAAGGAGGAAGTCAATTGTCCCTGTTTGCAGATGACATGATCCTCTATAG
GAGAACTAAAATATTCCACTAAGAGGCTATTGGAACTCATAAGAGAATTCAGCAAAGTTG
TAATATAAAATGAACACACAAAAATCAGCAGCATTCTTATACACCAACAATGCTCTGGCT
GAGAACAAACTTGTCCCATTCACAGTATTATAAAAAAAAAATGTAAAAACCTAAACACCT
TCAGACAGGGGTCAGGTGCTGTGCGGCACTGGTTAAGCTTTCCCCTGCAGCATCCCATAT
GGGTACCAGTTTGAGTCCCAGCTGTTCCATGTCCAATCAGGTCCCTGCTAATGTGCCTGA
GAAAGCAGGAGGAAGATGGCCCCAAAGTACTTGGGCCCCTGCACCCATGTAGGAGACCCA
GAAAAAGCTCCTGACTCCTAGCTTTGGAATCAGTTCAGCTCCAGCCATTGCAGCCATTCG
AGGAGTGAACCAGCAGATGAGAAGATCTCTCTGACTCTCCCTCTCTCCGTAACTCTGCCT
TTCAAATAAATAAAATAAATCTTTAAAGAAAAAAGTATTCTGTTTGGGAGATATGGCCTT
AAATACATGTGTTTGTTTTTGTCTAACAAATATTAGGTCTTTCAAAATGATGAGATTCTA
CTTCACTGGTCTGTGTTTCTGAAACACATAATAATTGTGAAATTCTGATTTAGCAGAAAA
AAAAAAACACACAAAAAATTAGGTCTTATGTGCCAGTAGACCTCATGGGCACTGGGACTA
CAGAGGTGTGTGTGGGTGGCCGTGGTCCTTGCCCTCAGCAGTGAAGAGTCTGGTCCACTC
CAGAGTTCTCCAACTCAGAGAATGGGGTAAGTATTGCTAAACATAATAATTGCCACATAG
TCATAAATTAACTGGAGAGACCTAATCTAACCTAAATTCAGGAAAGGGTCCCTAAGAAAG
TGACTTCTGAACTTGATAGGCAGAGAAGAAGAAAGTCTTTCTAGGTCAACTGCTCAAATT
GGGGGGCATCTGCCAATCACCGGAAGTATTTTTGGTTGTCACATGGATGGGGAATAACTA
GGAGGAATGCTGTACAATCCACAATGAATGGTCAACCCCCCTAAAACAAAGGATCTACTC
CAAAACAGCAGCAGTACAAGAGTGAGGAGACCTGGACGTTGCAGCAGAAACAGCGTAAGC
AAAGGCCCTGTGGTGGGAAAGCTAAAGTACTTGGTGCACGAAGTCTGAGGAGACAGGGCT
GGCACAGTGGCGAGAACCAGCGTATGCTAGCGTTTGCAGACCAGCCTCTCTTCATCACGG
AAGGATTGAGAGCAGGGCAGGGACGTGATCGGATGCATGTTTTGACAAGACTACTTGGCT
GCTCACTGGACCTGGAGAGAGGCAGCGGGTACCTGAGCAGAGCATTCAGGAGGTCATTCC
AGGTGTCCAGCATGTCAGGTGGCATGACGTGGCCACAGGGCGGTGGGGTTGGCGAAATGC
GGACTGTTGAGGAGTCTGCTGGCGATGGATCAGAGAATGCAGGAAGGGAGTGGAAGGTGC
CGAGGAACCTCGTACAGTTCAGCACAGATGGGTGGGCTGTCGGCCTGTTGAGAGGGGTGT
GATCTATAAATGAGAAAGTACTTGAGAAGAAAGGGGTGAGACCCTGAACTGGTGGAATTT
GGCAGCGCGGAAGAGGAAGCAAAGCTCCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved