Oryctolagus_cuniculus Locus Mono:151:SNORA30
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:151:SNORA30
Oryctolagus_cuniculus
Mono:151:SNORA30
scaffold_163676
SNORA30
1001..1124
2124
TCACTGGGATCAATATATGGTTTTTGAGAGTAAGGTTTTGGATGGCTTACATCACATTG
ATCCTGAAGTCAGGAAGAATAGGCTCTTTAAAAAGTCTTAGCAAGAGAAATAGATGCTGA
ATTAGAGTAGTAACACTGGAAATGTAAAGAGGAAGACAGATGAGAGAAGCATTGTGGAAA
TAGAATCAATATGTCTCTGAGACTGGATGCAAATTGGGAAAGCAAAAGTGGGAGAAAAAG
AAATCAATAATAGCTTTCGAATTAAAATCCCAGGTGACTAAAGATTATAAAATAATGAGT
ATAAAGATTAATTTAAAGAAAAATGAGTCAAGATCAACAAATGATACATAAACATTAAGT
AACAGATTTTTTGCTGTGCAGATTTAATTTGCAAAGAATAAATACTCTACCACAGCAGGT
CCCACTCTGACATCACAGTTATAAAAGAAAGTTAAAAATCAAAACAAACAAACAACAAAA
CAAAACCAAACTCAAAGAAAATTTCCACAAACCATTGTCAGGTTCCATCCTAAAAAATGC
TGATTTTTAGGTCTATGTTGCACCATGATGTTTTGTATTTAAAAAACCAAAAACAAAACA
AAAACTTCTAAAGATCCATCAGGGTTTGCACTTTGGCATAGCTGTAGCACTGGCATTGCA
TATGGGCACCAGTTCGAGTCCCGGCTGCTCCACTTCCGATCCAGCTCTGCTATGGCCTGG
AAAGGCAGTGGAGGATGGCCCAAGTCCTTGGGCCCCGGCCTCCACGCGGGAGACCCCGAA
GAAACTTCTGGCTCCTGCTTTGGATCAACTCAACTTTGGCCATTGCGGTCATATGGAGAG
TGAACAGGCAGATAGTAGAATTCTCTCTCCCTGCCTCTGCCTGTTTGTAAGTTGCCTTTC
AAATCAATAAATAAATCTTCAAAAAAATTTCAGGGACTAAAATAAAATATGAGAGAATAT
TTTTTAAGAAAAATTCCTCAAGTTCAGAAATTACAGATCCATTAGCACTTTCACAGGTCC
TCTCCTAGGCCCTGGGGCCAGCATTTGGCAGCTGGTACTGAAATCCCTTGTTATATCTTT
GCCCTGGGACTGTACCAGTGGCATTTGACACTCAAGTGGACAGAGATAAAAATGAAATTA
CAAATCCATATAAACTGTGCATAAACTGATTAAGTAATAACAGTCTTAGACCATTCTCCT
CTCTTTCCGGGAGGGGTTCATACAGAAAATATGACGAATTCTTTATCCAATTGGAAACCA
ATTTATTTTTCAGATGGGATCTTATAAAAATTCCCCCAATGGAATAGAACACTCAGTTTT
ATTTATTGCAGATGGTGGAGATAAACAAATGGTGTATGTTAGATAGACATTGCTGCATTA
GTATTACACAAGTGTTTTACTGATGATTATCATAGAAAACAACATTTTGCAGGACAATTT
GGAGGTACTCAGAGACATTTTCCAAACTCAACTAAAAATTAGTTTGCTCCATGAAACTAT
AAAGAAAGGTAACTAAAGGGGGCATAAATAAAGATTTTGGGAACACAGCAATAGAAATTA
AGCAAGTGAGATTAACCAAATGGTAATTATCCATATATATATATATATATATATATATAT
AGCAAATTAAAATGAAGAATCAAAACTATTGCTAAATCAAATAGTAAGGACAAAATAAGG
TTTTACTGGAGTTTCATATTTTCAGTGAGTCTTGAGTTACCAATGACATATATAAACTGT
TATCTCCAAGAACTCAATTAGAGTAGAGTGGCTAATACTAAGTTCTCAAATGAGATAGTT
TTTGAATGTACACAAGTCAAGAGCAGTATTATAACTGTTGAGAACATGAGTAAGCTATAA
AAAGTGATTATTATAAATACATACTGCTACTTTACTAAACTTAGAAATGAATTTTTGTAT
AAATAAAACAAGTTTACTTAGAAAGGATTTTTAGTTTATAAAACTACAATATCCCACTTG
AAGGAATAGGACACACCAATGAAGAGGAAAAATTTTAAGGTGACCCCTAAAATGTATACT
GTCAAGATTTGTCACTTCTGTTAATGGTTGACTTGAAAATTCTTCTTTATTTTTCCTTTT
ATGTAAAGAAAAAAACTTGACTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved