Oryctolagus_cuniculus Locus Poly:7:SNORA71
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:7:SNORA71
Oryctolagus_cuniculus
Poly:7:SNORA71
scaffold_84798
SNORA71, SNORA71, SNORA71
1001..1133, 2888..3019, 4504..4636
5636
TGCACAGCCTGGGGCCTGGTGGAGCAGGTGGGGGACTGGGTTTGGGGACTACAAGGAGC
TGAGGTCAGGTCCCGGCTGGGTTCCCTGCTTCTCTTGAGCTTTGCCGTTTCTGTAGAGTG
GGGAGCCTGAAGGAGTGCTGTGAGGGCAGGGGCCTGGACTGGGTTCCTTGTTTTTAAGCC
CAGGGTGCTGGCTGCCTGGGCGTACTCAGTATTTGTGAGATGAATGACTGATTCAGGCAT
GTTTATCAGACGTTGATAAACAGAAGCCAGTGGACTCGATGGGCACAGATGGAATTTTTT
AAGGTAATTTTTCATCTTTTTTAAAATATTTATTTATTTGAGAGGCAGAGAGAGAGAGAG
AGAGAGGTCTTCCATCTGCTGGTTCACACCCCAGATGGCCGCAATGGCAGGAGCTGGACC
AATCCAAAGCCAGGAGCCATGAGTCTCTTCTGGGGCTCCCACGAGGGTGCAGGGGTCCAA
GCACTTGGGCCATCTTATGCTTCCCCAGGCCATAGCAGAGAGCTGGATCAGAAGTGGAGC
AGCTGGGACTTGAACCCGCGCATATATGGGATTCTGGCACTGCAGGCGGTGGCTGTACCT
GCTACACCACAGCACCAGCACTTTTTTTTTTTTCATTTTTTAAAAGAATTACTTCTTTAT
TTGAAAGAGACAGGTGGATAGAGGTCTATCTGCCAGTTCACTCCACATATTCCTGCAATG
GCCAGGACTGGACCAAGCTGAAGCCAGGAGCTGGGCACCCAATCCAGTTCTCCCACGTGG
GTGGCAGGACCCCAACTACTAGAGCCGTCACCTGCTGCTTGCCAGGATGCACCTTCAGGG
GAAGCTGGACCAGAACCGGGCACTCTGATGTGGTACGTGGGCATCCCAGGTGGAGTGGAT
GGGACGTGGATGGGAAGTGAGGCCTGTATAGCACTCAGGGCCCTGGGCTTGTGCATGGAC
ACTCAGCTGAGCCTGGCCTCTGTTCTTCAGTCCTTTTCTGCCCCTGCATTCGAAAGTGAT
CGTGGGCTGCCCGTGCCCTGGTCATTGATAGTGCAGGGAGAGCAGCTGCTGAAAGCGCTT
CCCCGTGTTTGGAGGGTCCGCGCCGTCCCTGCCGAACCCTGGAGCGTTCGCACACCTCCG
CCCTCTCAGCACCTTCTGGATACCTCCTGGCAGCTGGTGGCTGGCCTGTGAGTGCGCCCT
GTGCGCGGCTCCCTGCTGGGCCTGTGTGGCTTGGACAGAGGAGGAGGCAGCGTGCATGGG
CTGTGTCTGGAGAAGCTCTGGCTGGTTGTGCCGGCCTCTCTGTGGGACATTTCTCACCAA
GCGCTTCCCTCCTCTCCCCTCTGCAGATCCTTAGCCACTGGGGTCCCAAGGCGTGATGCC
GTCTCAGAAGTGCATTGGCAGAGAGGAGAGCACTAGTCCTCCTTCATGGACATCCTCGTT
TCAGCCCCTGGCAGGTGTTCGGTGGTCAGCAGCTGCAGAGCAGAAGAAAAACAGGAGAGG
AGAAAAGGTGGGAGCACTTTCTTGTGAGCCCTTTCCTGAAATTGTTCTTCCCTCTTTGCC
AGTATTCACCCATCTGAGGTCCCTTGGCTTGAGGTGGGCCCCAGTTATGGGTGCAGGGGC
CAGAGTAGGGAGGAAATTGGACCTTACCTTTGTAGGGGGACCACAGGTGCTCCTCCCCCA
GCCACACCAGGCACTGCCTGTCCAGCATCACCTGCTCCCAGCCCTGTCCCAGAGTCCACG
TCCTGCTGAAGACACAGCTCCTCTAACCGCTGTAGTTTCATCAGTTTGTACAGAAAATGA
TCTGAAGAGCCCCACGTGCCACAGAGAATGTGTTGCCCCCAGGGGAGTTGTCAACTTCTG
TCCTTGTTGACAAGAAAATGGGTTAGTAAAACAGCCTGCCTGTGTGACACAGCTGGCTTC
AGAGCCAGAGTCTCCGTGTTCCCAGCGTGCATTGGCCAGGTGACGTCATGGTGGCTCACT
CAAGATTCTTGCTTATTGCAGAGGAGGCAGCTCGGTGCGGAGGAGCCCATGAGCGGGGTC
TCCCTCCTGCCACGAGGTGGCTGGACCGTGGTGCTCCCCAGGGTATGGTCTGTCCTGGGT
AAGATCCTGGGCTTTGCGTGGTGCACACATGTGTCCATGTCCCTGGGAAGTAAAGAGAGG
CAAAGCGAGGGTGGCTTCCTCCTGGCCTCGGTTTACCCTCCCTAGGGCCTTGGTGTGCTT
GTGTCCTTAGGATCTTCTGGCTTGAGCTCTGAGCATCTGCTGGGAGCCCTTCCTCCCATT
TGTGTGTTGGCACTGCAGTGTCTGCATTGGAATCAGGGAGGATTTGGGCATCAGATCCCG
CCGTACCCAGGTCTTCTTTTGAGAGGTAGAGCTACATAGAGAGGGAAAGACAGGTCTTCC
ATCCTCTGGTTTACTCCCCAAATGGCCGCAATGGCTCATCTTCCACTGCTTTCCCAGGCC
ATAAGCAGAGAGCGGGATTGGAAGAGAAGCAGCTGGGACACGAACTGGTGCCCATATGGG
ATGCTGGAGCTGCAGGCAGAGGCTTAACTTACTAGGCCACAGTGCCGGCCCTTGTACCCA
GGTCTTGTCACATCACTGCTCCTCCTGACCTGGGGACCTTCTCAGATCCTTGGTGTCACC
CTCCAGAAAGTAGGATCCTACAGTGAGGTAGGTTTTCTTAACATCACATTGTCAGCCCCT
GTCTCCTGCAACCAAAGCATTGCATGTGTTTTCTTCCAGGGCTGTCTTCCTTGGCTTCAG
TGTCTGGACCGCGCGAAAGGAGTCTTTGTAGGAATAGAAGCGGCTCTTGGGTCCTTGTGC
TCGTTTGGCTGACCGTTTGGGCTTCTGCCATTGGCCTCTTTTCTCAGCAGCCCTCTGTCC
TTTTCTGCCCCTGCATTCGTAAGTGACCACAGGCTGTCCGTGTCCTGGTCATTGGTTCTG
CAGGCAGAGGAGATGCAGAAAGGGTTTCCCTGTTTGGAGGGGCCGTATCCTGGCCTTCCA
GCTCTAGGAATGCCCTCACACTGCAACTCCATTTGCACATTCCTCAGGCCTCCAGAGCGT
GCGGGCTGCCATGTGTGTGTGTGTGCGTGACTGGTCTTTGTGGGGCTTTCGCTTCCTGCC
CCCACTGTTGGGAACTAGCCTGTGTGTGTTCCTTCCATGACTGACTGCCATGGCACACTC
CCATACGCCTGGCCTTGGCTTCCTCTTCAGCCTACTGCGATGACCTGCACATTAGTCAGT
CTGACCCACCCTGCCGCAGGCCCTCTGCTTCTCCTCATTTAGAACTGCTGGGGCCAGCGC
TGTGGCGCAGCAGGTGAAGCTGCCACTTGTGGTGCCAAGCATCCCATATCGGAGTGCTGA
TTCAAGTCCCAGCTGCTCCACCTCTGATCCAGTGCATCCTGGGAAGGCAGCAGATGATGG
CCCAAGTGCTTGGGCCTCTGCCACCCCTGTAGGAGACCAGATGGAGTTCCTGGCTCATGG
CTTCAGCCTGTCCAAACTATTGCAGCCATGTGGATAGTGAACCAGCAGATAGAAGATCTC
TCTCTCCCTCTCTCTCTGTCTCCCTTCCTCTCCCTCTCTCTCTTCTCTCTGTGTCACTCT
GCCTTTCAAAAAAGTAAATATTTTTTAAAGGTCCTTTTTTTAAAAAAAAAAAAAGAGAAC
TAACCTTTTTCATGCCCTCATCTGTGGCATGCTTGCTCTCTGTGTCCTCTATGTGAAGCC
CTTTCCTGGGGACTACTGTGCCCTGCTCTGAGCAGGGACAAGCCAGGTGCACATTCAAGG
ATTTTTGTCTGTTGCAGGTGAGTCCACTGTATGCAGAGGCATCATGGGAGTTGAAATGTC
AGGAACATTCTAGACCCCAGTCTCCTTGAGGTAAGATCTCTGCCCTCATCCATTGAGTGC
TGCTTTCTTGCATTGAGCGCAGTCTGGCTCCTGTGGCCAGGGCCGGGGGTGGTGATGAGA
GGTGAAATGAAGGTGGTACTGCGGGTCCACAGATCCAGTGCCCACCCCAGGCAACCCAGA
TGGCTTCCGGCCCTTCACACGGCTTCAGCAGCTGCTGCCGACACAAAGCTGGGCCCTCCT
TGGGTCATGTGAGGTCTCCGGGGTCTGCCCTCCCTCTGGGTGTCAGCAGCAGCGAGCGGT
AATGGAACATGGGTGGTCTGGACATCAAAGGCCCCAGTCCCTGGCTTTGTGTCCCTGTCC
GCCAGTAGCTCAGTCATCAACTCATCTACAACCTGACTGTCTTCATTTGAAAAACAAAGC
TGTGATGGAGGAGACTTGTACCTGACACATGATTCCTGTCATTCCCAACCCTATTTCCCC
ATTATTTTTACCCAAAGGGACATCTCTTTGATTTCCCAAGGCAGGGAGGTTTTATGGGAC
TTCTACTGGGAACAAGGGGCCAATGCCAGGGCCCTGTGCTGGCCTGGGTTGCTTTCCTGG
GCCCAGTCTGTTCCACAGGCTGCTGGCACCCAGCTTCTCCTGGGATCTTTGTGCCCTCGT
GTGCACCTGCATTCAAAAGTGATCATGGCTGCCAGTGCCCTGGTCATCTGTGATGCAGGG
AAAGGAAGTGCTGAAGGCCGTTTCCCGTGTTTGGAGGGTCCACGCCTGTCCCTTTCAAAT
GCTGGCGCTTTCACACACTCCCGCCAGCCAGCATCCCCAAGCCCCAGCGTTGCAGGCTGC
CGTGAGAGCAGGAGGCTGCCATGGCTTGGCCTTTCTCAGCGTGGCGTCTCGCTGTCAGAG
ACCAGGCTGCATCGGTGTCGAGATTTAGATACTTTAGTGGGTGAAGGAGTCCAAGAAATT
ATGGGAAGCAGATTAAGTATGGTGTTGGGCGGTATGTCATCATTGCCATAAGATGTTCCA
AGACAAGCAGCTTTTTGGAGGTTATGGGCCTAGAGAGGTCGTTCAAAGAGGGGGGGTTGT
GAGGGCCAGAGGAAAGTATTCAGGGGATGGCAAGCAATGGGGCTTCGAGACTGGGGTCAG
CCCAGGCTGACCGTCCTGCTGGGAGACAGCTGTACTGGCAAGTCAAGATAGCATGGCAGG
GGGTCCCAGCCAGTGGAACCTCAGCAGGACGAGCCCTGAGGGCCAGCTCTCCGGCTGTCA
AATGGTGCCAGTTACACACCTGCTCAGTTGTCCTGTAGGGGACNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGATTGTGATGCT
AGGTTTAGAAACTATGTTCAGGGCTGGCGCTGCGGCTCACTAGGCTAATCCTCCGCCTTG
CAGCGCCCGCACACCGGGTTCTAGTCCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTG
TGGCCCGGGAGTGCAGTGGAGGATGGCCCAAGTACTTAGGCCCTGCACCCCATGGGAGAC
CAGGAGAGGCACCTGGCTCCTGGCTTCAGATCAGCGCGGTGCACCGGCCGCAGCGCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved