Oryctolagus_cuniculus Locus Poly:5:SNORD115
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:5:SNORD115
Oryctolagus_cuniculus
Poly:5:SNORD115
scaffold_89772
SNORD115, SNORD115
1001..1079, 4032..4112
5112
TGGAACTGCTGGAGCCCTGATTCAGGGACATGCCACCCAATGCCTGGTCAGAGGATTGC
CATACCTGGTCCAGGGTACCTGCATAGTGGTGCCAGGCATATCCCATCTCTGCTGCATAT
CTTTTCTAGGGGCTGGCCTTTGCAGGCTATGTGGGTGGGCTTTAGATTGAGTTGAGCCCA
GCAAGGATGCCAAGGCCCTCCTGTAGCCCAATTCCTACTCCTCCAGGGGAGGCAACAAGA
CCCCAATGTAGGGATGGGCCGTGGTCTAGTCTGATGCTGGTACCCCATCTTTGGGATATG
TATGGGACTTTGAATGGCAGTGACCACAGGAGGAAAATATCTCCAAAGGGTAGTTCCTGT
GCTCTAGGAATCAAATGTGTGCATGCCAGCTGCATTTGAGAACCTGGGCTTGTACAGTGA
CACCTGTTGTTAGGCCCAGTGCATTACCAGGGCCTCCTTGGGTGTGTCTCATGTGAGCAG
ACCTCTGAACTCAATTGGGTGTCATCACTTAGTTGTCCAACCTGGGTACTGGCTGGAACC
TAGGTACTGGGGTCAGAAAGGAGCTTTAGGGGAAGCTGTTTCCAGTAGGGCAACCTAGTC
CAAGTAACTCTTTCTGGACCAGTGGACAACAGGCGCAGCAGTTCTTGGGCTAGGTATGTG
GAGTTTGTCTGGCTCGACCACACCTACAGGGGTGGCTTCCTGGGAAGCCATACTTGGGCC
GATGGAGCCAATGCATGCTCTGGAACAAAGGCACCCTAGCCTGCCCCTGCTGTGTTTTCA
CACCTCCCTCCTCCCAGTCCCACAGATGTCACCAGTGGAAACCCTGCTAGGGTACCAGTG
CCCAACAAAAGGACTGTGGTCAAGGGCCCTGTGGCCCATGAGCTGGGGTGCCAGCCATGT
TGGAGAAGGAAACATCCATGACTGCCCAAGGTAAGACAATCAATCCAGGCTCTGGATGTA
GCATGGTGCCTTGTGCTTCCCGCAGGGTGGTCCCTGAGGTTGGGTCGACGATGAGACTTC
ATGATGTCTCGAGGAGATGATGGCTTAAAAATCATGCTCAATAGGATTACACTGAGACCC
AGCATAGAGACAGTGGTGCAAGAGTACCCCAGGGTACCCATGTGCCTTCTAGGGTACCCG
GGGGGATGGAGACCTCAAGGCCATCCAGGCCAGGATGCGGTCTGCAGCAGGAACAGCTAA
TCGTTAAGGATTCACACAAGCTATTTCTTCATTGGGCTTGGTGTATTTTCTCCACTGTAC
AAGTTGCTGGGCTGCATTGTGGGGGGGCTCCTCCCTCAGCTCCTGTCTGCCCCTTCTATC
TTTCACTGAGAAGAGATTCCAGGAGGAGCACCCTTGGACCATGGGTTCTAGATGAGTGAA
TGGAGAGTGTCATTGGGCCTGTGTGGGACAGCAGATTGTCTGGATGGATCACCTGACATG
AGCCTGATGGGTGGAACCACAGAGACCCAGGGAGATAGCCTCCAGCCATGTTCCTGGGTG
AGCTATGTCTCCTTGCGCTCTGAGGTGCATATCAACTTACCTGAACCCCTGCCATGCTGA
GAGGGCCAAGCGAGGAATTAAAACACTCCCTGGGGGAGGGGTCGTGTGAAGCCAGTGTCG
CTACTTGAACAAGGTGGGTTACAGTAGCTCTATATTGCCTTGCTGGTGTGTGAAGAAGTG
AGTAGTTACTGGGGATCAAGCCCCTGAGCAGCAGTAGGGCTCAGATTCACAAGGAGACAC
AGGCTGAGGAACAGGCCAAGACAGTAAGGGAGGTTTTGTTGGTACAGCCCCCAGTGCAGC
TTCTCAACTTGGAAAGTGGTGAGCACACACCAAGACCAAGGAATATGGGGCTTGGTACAT
CCTGCACAAGCGACTGCTCAGTCCTGCCTCTCCTGAGGAACAGAAACAGTTCCTGAGGAG
GGTTCATGAGGGGCCATGCTACCTGTCAGCCTAGTGGGCTGTAGTGGCTCTGCATTATCT
TGCTGGTTTGGCCAGAAGTGGGTGCACACAGGGTAAGCCTCTGTTGGGGTGGGGGCACAG
ATTCATTTTAAGGCCCAGGCTTAGGACCACACCAAGGCAGGGAGATATTAGCAGGGCAAC
CAGCTCTGCAGGTACCTGGGAGCTTTATGTGGGCCATGGTTACGAAGGAGCCTAGGCTGC
AGGGAGGCTCTGGCATGTCCCTAGTAAGGGAGGTGGAGACACCAAGCCCATGGAAATACA
GGGTGGCACCAAGCATACCCTATCCTCTCCAGGGCTTGGTCCAAAGGGGAAGTTTTCTCC
TCCATATGGAGAAAGGTCCCTCCTTGTCGAACGGCCCATTCTTTCCACTGTGCTTTCACT
CCCCAAGATCTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTAGCCATTCCTAGCACAGTGACCCAACCTGAGTTGGCCTTCTCTGGTTCAATG
TCCAAAAGGCCCAGCAGTTTGCGGCAAGGTGTGTGGAGCTTTCCTGAACCAATATGACCA
CAGGGATAGTATCCTGGGAAGCCTCACCTGTGCCAATGTAGTCAAAGGTCACTCTGGAAC
CAGTACACCCTACCCTGCCCCTGTGTCCGTTCATACACACCCCTTACCTGTCCCACAGGT
GATGTCAGCAGAGGAAGCCACGTGAGGTCCAAACCCCATGCAATGGATCTGTTCAGCGAC
TAGTGATCCACCAGCTGGTGGTGTTAGTCATTGGAAATGGAAACTTCTAGGACTGCGCAA
GGTAAGCCAATCCTCCCAGGCCCCATCGGTGGGATGGCTCCCAGGGCTTCCTGGGGTGTG
GTTCCTGGGGTTGGGTCAATGATGAGACCTCACACTGTCTTGAAGAGAGATGATGACTTA
AAAATCATGCTCAATAGGATTACACTGAGGCCCAGCCTAGTGGCAGTGGTACAAGAGGAC
TTTGGGGGTGACCAGGTGCCTTCCTGGGGAGGAGACCCTGGGTACTGGAGACCTCACAGA
CCAGGATACAATGCCCAGACTGGGGTGACTGCTCTTACAGAATGCACCCAAGCTCCATCT
TGAGCTTGATGTATGCTCCCCACTGTCTGAGTTTCAGGACCATGCTTGGGACTCCTTCTT
CACTTCCTTTATCCCCTTCTGTCTTACTGTGAGAGGAGCTGCACAACAGGGCATTTTTTG
CCCAGTTTCCAGGTGAGTGTATGGAGGGTGTCAGTGGGCTTGTGTGGGGCAGTAGGGGTT
TCGGAGAGAGACCCCTGAAGTGAGCCTGATGCATCAACCCATGGAGACACAGTAAAGCAG
CCTTGGTCCGAGTTCCTGAGTGAGCTGTGTCCCTTTGGGCTGTGAGGTCCAGAATGCCTT
TCCTGAACCTCTGGCCTGTTGTGAGGGCAGAGCAAGGAATGGAAATTATTCCTAGTGTGA
GGATTGATGTGGAGCCCATGCTCTCACTTTTCACAGATGGGCTGGAGTGGCTCACGATTG
CCTTGCTGGTATGGCCAATGTGGGTGGGCAGTGGGGATAAGACCTCTCTGCAGGGGCAGC
TCTCAGATTCCATAGAAGGTCCAGACTGAGGACCACACTGTGGCACTGAGGGAGTTTTGG
TAAGGCAGACAGTTCTGCAGGTGTCTGGCAGCTTGGGAGCTTCACATGCATCGCAAGGCA
TGGGACCCTAGTGGGCATGGTGCTCCAGCCAGTTCCTGGTCAAGGCAGTGGTGACAACCT
GGCCAGGGCACTTGTATAGTGCTGCCCACCATGCCCACCAATGGTACCATTTCATCCAGG
AGCTGGCTTTCCCTTGCCACATGGGGACTCTTTAGACAGAGTTGAGCCCAGCAAGGATGC
CATTTACCCTCCTGGATTCAGGCTCCTGTCATCCATAGGAGGCACCAAGTCCCCATGACA
GAAATGGGCCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved