Oryctolagus_cuniculus Locus Mono:198:SNORA31
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:198:SNORA31
Oryctolagus_cuniculus
Mono:198:SNORA31
GeneScaffold_7150
SNORA31
1001..1126
2126
GGGCCCTGCACCCTCATGGGAGACCAGGAGAAGTACCTGGCTCCTGGCTTCGGACCGGT
GCAGCGCGCCAGCCGTGGCAGCCATTTGGGGGGTGAACCAACAGAAGGAAGACCTTTCTC
TCTGTCTCTCTCTCTCACTGTCTGTAACTCTACCAGCCAAATAAATAAATAAAATCTTAA
AAAAATTGCACAGTTCTAATCATATGGGCACTGTTTTTTGGCTTTAAACTTTAAACAGAC
AAATATTAAAGTATGGAACTGGGGTTATAGAAGAGAATACAAATGCTATCAACCTAGACT
AATAATGTTTCTGTTCTGGTTCTATGCCTGGATTGAAAAGGTATAATTAATTAACCTAGA
AGAGAAAAGCCTTTTACATCCCTGGGATGCCCCTATCCACATGAAGCTGTAAGTACCTGG
GCAGCTCACACAGTGGGGACCAGGTACGGAGCAGCAAACCTCCATCCAGTCATGTTTTGC
TCCTCTAGTCAAAGCTGATGAGTGTTAACTCTTGGGCCTCCAGCTCCTGTTGGTTCACAT
AGTGAGTTGGGGACTCCACAACTTCAAGTAAGAGATGAGATCATACACTCCCTATCCACA
TCTACCTGCCCCACACCTCCCAAGAAGCCAGTGCTGTGAGCTGTAGCCACCAGCATTGCC
AGAGGTAACTGGCTGGCTGCACTGCTAGGGGAAGTCATTGGAAGGCAACAGTGGCAACAG
CCACCTGCCAACCTTCAGTGGTCCAGCTGAACCCACTTCCTTTGAATGATCATCCGCTCA
CTTCTCTGGGAGTCTCTTGTCACCACCATGATCATGGACATCCTCATCAACTGAGACTAC
CTTACCAGACACAATCAAGAAAACCGACCAGGAGCTCACAGGACTGCTGCCACCACCTGC
TCCATCTACCTGGAGGCACCTGCAATCCACTCTGGCCACCCATAAACACACATTCGATCC
ACTCCTCTTGATCCACAAAGCCCTCTGAATCTCTGCATTCAGGCCCTTCTGTATTACACC
TTGAACAGTTTGTTGTTGTTATTTTGGTTTGCACCAGGATGCTAAAGAAAAATCCCTGTA
CTTTCTCTGTCTTTGTGGCAACCCAGACTGAATTGCGGAATACATTTGTATATATAAAAA
AAAAAGTTTGTGGAAAATGAAATTAAAAGATAAATGTTTTTCAGTGCCAAAAATTTTGAA
ATCCATACCTAGCTTTTTCACATTATGCATTTCCGGGGCTGGGGCTGTGGCATAGCAGGT
AAAGCCACTGCCTGTAGTGCCGGTATCCCATGTGGGCACAGGTTTGAGTCCCAGCTACTC
CACTTCCAATTCAGCTCTCTGCTATGGTCTTGGAAAGCAGTAGAAGATGGCCCAAGTCCT
TGGGTCCCTGCACCTGTGTGGGAGACCTGGAAGAAGCTCCTGGCTCCTGACTTTGGATTG
GTGCAGCTCCAGCCATTGTGGCCATCTGGGGAGTGAACCAGCAGATGGAAGACCTCTCTC
TCTCTCTTTCTCTTTCTCTCTCTGCCTCTCCTTCTCTCTCTGTGTAACTCTGACTTTCAA
GTAAATAAATAAATCTTTAAAAAAAAAACACATTTCCCATGAACTTTACTTTTTAAAAGA
TTTTCTTGTTCATCTGAAAGGGCAGAATTATAGAGACTGAAAGCTCTTCGATCAGTTGGT
TTACTCTACAAATGGCCGTAATGGCCAGAGCTAGGGCCGATCCAAAGCCAGGAGCCAGGA
GCTTCTTCTGGGTTTCCCATGAGGCTGCCGACAGGGGGCGCACAGTACTTGTGTCATCTT
CTGCTGCTTTCCCAGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved