Oryctolagus_cuniculus Locus Poly:32:SNORND104
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:32:SNORND104
Oryctolagus_cuniculus
Poly:32:SNORND104
GeneScaffold_5803
SNORND104, SNORA76
1001..1070, 1294..1425
2425
GGATTTGAAGCAGGGCAGCACTGGAGCCCAGGCCGTCTGATATGGGATGGGGCCCTCCT
AAGCGGTGTGCTAACGGTAGTGCCTGCCCCAAATGGAAAAGAACTTCTAAGGAAAATGCA
GGAAGGCGGTAGACAGGCAGAGTTCCCTCTCCACAGGTCTTGGAGGGCAGGTCCGTGTCC
TTACTCATTTCCCTGGACATCCAGGGACCAGCACAGGGCCTGGGCTCCCGAAACGCACGC
AGTCAACTCTGCGAAGCACTTCGCGCTTTCCCAGGCACGGCCTCTCTGCTTTGGGCTTCT
CATAGTTGCATTTTAGCATTCAGTGAAGTATTGCCATCACAGTTTGCCCCATCACCTCAG
TCCTATCAAACATACGTTTAGTTACCACTCACAATGTGCTGGCTGGCTGACATTAATTCA
CCTAGTCCTTGCAACTGTGAGGGGATATTCCTAAATTTTCAGAAAATGAGGCTCAAGAAA
GTTAAGCGACTGAGGTTATAAAGCTCTTTCTATTACGTTACTTGACTCCTGAAGGTTTTG
TTCATCTGTGTAACCTCAGTTCGTAGCCTCGCTCATGGCACAGAATACCTCCTGCTAGCC
ATGAATTGCTTGTCTCCTGTGGTCTGTAAATTTCCCTTAGTGTACTGTAGAGAGCTGCTA
ACACCGAAGGATTCAGACTCACTCAACGTGTCTACCTGCGTTGCTCTAGGCTCCCATCTC
TATGGTTAGCATGTGGGCACTCTATACTCAGGAGGACCCAGAGAGTACGGCCAATCATCA
GGCCGCCATGCAGTCACATGGTCGGAAGTTTCATTCGTTATTGGCTAAAAACGGGAGGGC
CCGCCCAATCACTTCCGGTCTGCTCCTTTAAGTAAAAGTGCTTGCGGGTTAGTGTCCTTT
CAGAGACTGCGACGGTAGGAAGGTGAGGTTCCGGTGGCTGAAGGGCAGCTCCGGCCTGGG
GCGCTGGGCCTGGAGCAGGGTGGAGGGCGAGCGGGCGGTCGGCGGTGATGACATCCAAAT
TAAAGCACGTGTTAGACTGCTGATGCGGGTGATGCGAACTGGAGTCTGAGCAGCCGCGGC
AGAGGCGGGGAGGCTTGCGGGCGGTGGGAGCCCTCCCTGAACCCCCATTGTGGTTCTTGC
AGGTCCCGGCTGCCGGATTTGAATCCGCCCCAGCGCAGGAAGAAGTCGGACTTGAATCAG
CCCCAGCGCAGGTTCAAGTTCCCCCGCCCACCCCTCCGAGCTTCTCAATAAAGGACTTTG
TTCTCATCGCTGGTGTCCGTGTGTCCGCCGCCACGCGCTGCCTTTGAGCCCCCGTCGCGC
CTGCGCGTGGCGCCGGGGGTCAGGCTGCAGCGCCAGAGCACGAGCTCGCCCATAACTGGG
GCCGCCTGTACCTCGCAGGCCGCCCTTTTAACCGCGAGCGACAGGGCGGCCGGGGCTGGC
GCCCGGCTTCCGCGCGAGGGGACCTGCGCCATCCCGGGGGCCGCGCGGGGAGGGCCTTGG
AAGGGGACGGAAGCCAGCCACGCCCTGGGGAAGCTAAGGGCTGGATCTCTGAAAGATCAG
GGGCCGGCGCTGTGGGCTAAGTCTGCGCCTGCATGAGCCGCCGGTTCGAGTCCCGGCTGC
CGCTCTCACCCTCCAGCTCTGCCTGGGAAAGCACAAGATGGTCCTGTTGAGCCCCTGCAC
CCACATGGGAGAGCTGGGAGAAGCTCCCGGCGCTGTGGCCATTTGGGGAGTGGACCAGCA
GGTGGACGTAACTGCCTCACATTTTAAGAGCTGTTTGAAAGGCCAAGTTACCCGTAGATC
TCCATCCGCTGGTTTAACTCCTCGGATGGCAAAAGCTATCGCTGCTTGGGCGAGGCCGAA
GCCAGGAGCTTCATCCGAATCTGTCGTGTGGGTGCTGGGCCCAAACACCTCGCCCATCTC
CCTCAGCTTTTAGCGGGGAGCTGGGTCGGAAGTGGTCCATCCGGGAAATGACCGGTTCCC
ACGTGGGGATGCTGGCTTCCACGCAGCTGCTTGGCCTGCATGCCACAGCGCCGGCCTGGG
CCTTGACAAGTGCTAACCCCTGGTTGCGACCTACTTAGAAACAATGGGTCCGGGGTCAAC
TGCCCGAGCTTTGGGCAAGTTAACAAGGTTTCGGTTAGCCCAGCATGATCGCAGCCTGCC
ATTAGTTCTCCCAGCTGAGGGGAATGCACAGGGCAGCAGCGGTAAGGCAAAGGGTGTGCA
AGTGAGGGGGGTTCAGAACTAAGGCAGCATTATGGCGGCCGAGCGGCACTCGACCTCAGA
CCCATACCACCAAGAGTTGTTTGCACCGAATAGCAAGTAAATTGCAAGCCTCCAGTTACC
AATCTTTAGTTCTGTCTCCTTTTCCCCTTAAAGCTGTTGTGCTTCATGGCTCTGGGAGTC
TGAATGGCTTCCTGAATCAGACCTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved