Oryctolagus_cuniculus Locus Mono:29:SNORA40
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:29:SNORA40
Oryctolagus_cuniculus
Mono:29:SNORA40
scaffold_200483
SNORA40
1001..1113
2113
CAAACAAACTAATATTGTCCCAGAAGCAGGAGCAAAATATGGCCTTTCTTCTTAGCTAC
CAAATACATCGCCAGTGCACTCAGTTCTTAAACAGAAATAACCCAGACTTACTCTTCCTC
AGTTTTGGATGAAAACATTAAAGAGGACAGTCTCATAACACATGTGTCTAGGGCAGAATT
CCAGCTGCGTGGGCCCCGATGCCTCCTGTCAGGCACCTCCAACACAGGGACAGTGACCCC
TCTTCAGTGCGTGATACACAGCTGTTAAAGGAGCAGTTGTACTGCCTGGGTTAAGAATTT
TGTTTTCATAAGGTGTATGTGACCTTTGGTTTGCATATTTTCTGGGAAAGACTTCATTTA
TACATCTTTACAAAAAGAACGTCCAGTTAAATATCGATCCGTTTTAGCCCCTTAAAGAAC
ATTTGGATGCATCTTGCTATTGTGGAGGGGTTAGATGAGCAGTTGCTGTTTCTTAACTTT
ATTAATTTAGATTTGTGCATTATAACTAAATCTGAGTCAGGTGAGCTCACAGGTATTGAA
ATGATTGCTGATTAACCACAGGTGTGAGATTATGCATGTTGTAAAAAAAGTATATTATCA
TTAAAGGCTTTGCAGTGCATACCTTTGTCTTTCTTCCTTAAAAAATATTTATTTGCTTAT
TTTATTTGAAAGGAAAGGGGCAGAGATAGATGAACACACAGAGGTCTCCCAACCACCAGT
TTACTCCTCCGATGACTACAACCACTGGGGTAGGAGCAGGCCAAAGTCGGGAAGCAGTAA
CTCAGTCCAGGTCTGCATTGTGGGTGGCAGGGACCCAACCACTTGAACCATGACCTGCTG
CATCCTAGGATGTGGATAGCAGGAAGCTAGAACTGGGAGTGGGGCTGGGTCTCAAACCCA
GGCACGCCACTGTGGCATAAAGGGATTAGAACCGGGATCCACATGGGATGCCAGCGCTGC
AAGCTGGGGCTTTAACCCACTGCGCAACAGCCCTGGCCCCTTACACTTGTGTGTGTTTCA
ACTAGTGGACATACAGGTGCAAAAAATAAATCCTGTTTTGCAACCCAGAACTCATTGATC
AGTATGAGTTTTGATATATACAAGCATTTATAAAATGAAAAAAAAAAAAAAGATGGAACA
GATAGAAGTTCACTCCCCAACCCTGAGGGCAACAGGTACTGGGTAGCATTGAACAGGGGC
CTTCAAATTCCACCAGGCATTTGCCCTGGCCAGGAATCAGCAGTTGGTCTAACAGGGGTA
AGCTGTTCCTTAAGGACCAGGTCAAGGAGAAAGGACTGACAGTGATCGGGGTCTAACAGC
AGCTGTGGGTTCACCCAGACAAGCTGCCACTACATATCGCGCCACACTCTAAAGGTTGGC
TCCCAGTGATCAGAGGAAAAGTCCCTGTAGGCGCCATCAAAATGTTGCAGGATGTGACTG
ATTGAGGCCAGCACCATGGGTGTTCAAAGAATTCACCAGAGCAGTCAGATAGAGTGGAGA
GAGTTAAATTCATTGAAGCTGAACGAGAACAACAGGCAGGCAGGCAGGCAGGCAGGCAGG
CAGAGGCTAATGGCTGCAACATGGACCATAATCTGAGGTATATACTTGTAATAGCAGTCT
CTTCTTAGAGAGAGTTTTCTTGTGGTCCAGCAGGTATTTCCAGGAAGGTAATTTGCAAGT
CTTGGTGTGGCTGGGAAATCTGCACTACCCTTAGCTAGGGATTTTCCCAGTCTGAGAAGT
GCCCTGGAACAATCCTCCATGCCAGAAGCATTAGCAGTGATGTGGGTGAGTGGGGGGATT
TATTTGGTTTTTCACTGCAGGTCCTTGTCATGCACAAAGATATGCATTCTAAGTACTGAC
TCAAATAAGGTAAATTTTATTCAAAAGCCGGCGCCGTGGCTCAATAGGCTAATCCTCCAC
CTTGCGGCGCCGGCACACCGGGTTCTAGTCCCGGTTGGGGCGCCGGATTCTGTCCCGGTT
GCCCCTCTTCCAGGCCAGCTCTCTGCTATGGCCAGGGAGTGCAGTGGAGGATGGCCCAGG
TGCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGATCCTGGCTCCTGCCA
TCGGATCAGCGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved