Oryctolagus_cuniculus Locus Mono:119:SNORA57
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:119:SNORA57
Oryctolagus_cuniculus
Mono:119:SNORA57
scaffold_137446
SNORA57
1001..1149
2149
AAGTCATGAGCTAAGTCTCTCCAACACCTAGACTTTAATCTCAATACATATCTTGAGAT
TAAGTATTAGGGAGCCTTGGAACTTCCGTGCACAATCTTCTGTTTTGGGGAAAACTCACT
GACTGGTACACACTTCTGTGTGCAGTTTTCTGAATGCAAACATACGTTTACTGGTAAAAA
AGTTTAAGTGGATGTACACTGTTACTTCAGGGAGTGGGGTAGTCGACAGCTCTCCAATGT
GGGACGCAGGCATCCAAGCGGTGGCTTCACCGAGACCCTAAAGGAGGCTGTAAGCCACAC
GCATAGACAGGCTAGCAGAGTTTGGGAACGAACTATCGACCAGCACAGATCAGAGCGCGC
AAAGCAAACCGGGGGTACCGGCTGCTCCGGCGTGGGCGGGGAGGGCCACGGGGAAAGGGG
TTGGCGCTCACGCCCGCTTCTTGAGGTGGTGCCGCGTGATCAGTCCCGCGTCTACCACAG
CCCCGACCACCCGACGCTTCAGTCGCCGCTCCCGGTTCAACACCCGCCGGCGCTTGAACA
GCTTCTTCTTCAGTTCCTGCGCCAGAGAAAATGCGAGTCAGAGGGACGCCGCGCGCCGCG
TCCCGGGACCCCCGCCCCCGGAGGCCCCGGCCCCTTCGATCCCATCTCGAGCGAGAGAAG
GGGGCCCCGCGACGCCTGAAGGGAAAAAGTAGCGACCCCACGCAGTCACCGTTCGAGGCC
TGTTGATCTTGCCCCCCGGAGGCCCCATGGCTGAGCCCGGACGCTCGCTCTCCGCCACAC
TTCCGCCGCACGCCGGCTCCGCAGGGCTCCGCCCCCAGCCCCCGCAGGGCTCCGCCCCCA
GCCCCCGCCGGCCAATCGCGGCTCGGGGGCGGGCCCTGGACTATATAAGGAGGCTAGGCC
CTGGCGCCGGTCTTTCCGCGCGCGCTGTGCGGGTGAGTCCTGTCTCCGCCGCCCGCCTCG
GGGGTGGGGGTCGGGCGAGGGTCGTGGGTGGGGTCTCGAACCCTCCCTTTCTTGGCGGGG
ACCGGGCGTACGATCCCGCTCCCCGTTATGTGCGGAGGCAGAGGAAGAGGGCTCCGGGCC
CCTCGGCGTCATGTCTTCGGTGCCGGCTGCTTCCCGTCCGCCGGTTCTATCCTCAAGCGC
CGAGACACGGCTCATCGAGCAGGGCAGAGCCCAGGGCCTGCGGGTTGCTCCCGGAGGGTG
CTCACGCCTTCTGCTTTGGTTTCAGGTCTGCGGACGCCTTCCTTGGACCAGGAGCTGTCA
AACCCCGCGCTCTGTTCCCTTTTGCGTGGTAACCAATAAAGGTTTGTTCGTACCGCAGGT
CCGTGTCCGCGTCCTTTTTCTTTTTCTTTTTTTTTTTAAACTCTGAGGCTGCATACGTCC
CTCGCGGCGCGGGAATTTGCCGACCTTCCGAATGCTCCACGTGCGGTCACTCGTGACATG
CGTGCCCCGCGCCTTGGCCGGTATGGAGGTGGGGAGGGCAAGGTGGGTCTGCCATGCCCC
GCGGTGTGGTCCCTGAAATGGTGGCTCCAAGAGCCTGCAGGCTGCAAATGGAACTCACGC
ACCAGGTGACCCAGGCTCCCTGTGTCCGCAGGCTCTCTGGCCGGTAGCTGCCTGGCGGAC
CGCTGCCTCTGGGATCGGTTCCATGCCCAGCTGCGTCCCGGCAGCGCCCCTACCTTCGAC
TGGTTCTTTGGATATGAGCAAGTCCAGGGACTGCTACTGCCGCTGCTGCAGGAGGCACGG
GCTGCCGGTCCACTGCGGGTGCTGGACGTGGGCTGTGGGACCTCGGGCTTGTGTACAGGC
CTCTACACCAGCTCCCCACACCCTGTGGACGTGCTGGGAGTGGACTTCTCTCCCGTCGCC
GTGGCTCACATGAACAGCCTCCTGGAGGGGAGCCAAGGCCAAACACCGCTGTGCCCTGGG
CATCCCGCTTCCCGGCTGCACTTCATGCAGGCTGATGCTCAGAACCTGGGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved