Oryctolagus_cuniculus Locus Mono:200:snosnR60_Z15
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:200:snosnR60_Z15
Oryctolagus_cuniculus
Mono:200:snosnR60_Z15
GeneScaffold_3504
snosnR60_Z15
1001..1089
2089
TTATAGATGATCTGATTCCTAGTGTAGAACACTTTCTCTTTCCTTTTTTTTTTCTGGTT
TTATTTATTTATTTGAGAGGTAGAGTTATGGACAAAGAGAGGGAGAGACAGAGAGAAAGG
TCTTCCATCAGCTGGTTCACTCCCCTGTCAGCTGATTTACTAACCGGCCATGGCGGCCGG
AGCTGAGCCTGTCTGAAGCCAGGAGCCAGGAGCTTCTTCCAGGTCTCCCACATGGGTGAA
GGGGCCCAAACATTTGGGCCATCTTCCACTGATTTCCCAGGCCATTAGCAGGGAGCTGGA
TCATAAAAGGAGAGCCGGGACATAAACCTTTACCTGTTGGAGATGCTGTTGTCACAGGTT
CAGGCTTAGCCTACTATGCCACAATGCCAACCCCCAATCTTATTATTCTTTTCTTTAAAA
CTTTTGATGGCTTTCCAGGCTTCTGCTCTCTCTTTCTAGGCTCTAAACCTAGGGAATAGA
GGAGTCTTTAAATCTACATGGGCATCATATTCACTGAATAACACCTCCCATATCCATGTG
CTGTGGGTTGACCAGGACTTGGCTCCCCAAACTCATGCAGATGTTTAAAATTTGAAGTCT
CAATTTGAAGAGCTGATGGATTGTAGATGAAGACTTGATCTAATTATGGTGTCTCAGAGG
TCAGCTTGCTGGGAGGTCTTTAGGTCATTGGGGGCCTGACCACAGAAAGTGGTGTTGCAA
GAGACTTGGTTGTTTTAGCCAAGTTCTGCCCAGTTTCTCTCTCTCTGCTTTCTGGATCAC
CTTGTGATCATTCCTCCTCATCCACTCCACCACGGCCAGCATCTACTATACACCAGACTT
ATAGGACCACCCGATCCTGAACTGTGAATCTCTAAACTATGAGCTTATCTCAGGTCTTTT
AGCTCAAGTAATGAAAAGCCAGCTGATAAGCCATTCATTGCTTTAAACTCACTCAGGTGC
TGTTATTAATAGCACAAATCAAATTCACTTCAAAAACTATATTAGATACAATGATGATAA
TATAGTTTAGCAGACCGACACTGATGAACAATATTAAAAATTATATTATCTTTCCATTTT
GAATATTGTAAATTAACAGATGCTAATTCTACTATATATAAATCTCCTAAAAATCACTCT
GAATTATAAAAAAAAAATTATTTGACTTCAAGAATTTTGATTGCCACTCTCCTGTAGCAT
AGTCCAATGCACAGAAATTTCTCAACCAGCAAGTGACATGCAACTGCTTGCGGAATTCTG
AATGCATCGTGCTTTTTCATATTCTAGAGCTAGCATGGAGCAGTTCCTTTCACTACATTC
CCTCCATTTCACCTGGATTACACCTACACAGGTTTTAAGAAGTAGCAGCCAGATACCCTC
CTCTCCAGGGAAACTTCCTGCCCACTCATCAGAGCCCATGGAATAAAAATGGGAGCATTC
CTCTAGTTTGGTGTGACTCCACTAACGATATGCCAATTAGATAGAATAATTGTGTGGGAG
AGTTAAGGGATACCCTTTTAAGGTCTGGCAGTTTTCGCTGTTAAAACAGTCTGGACACAA
AAATTTCCAGATACCAAGCTCTCCCTAAATGGCTAGGAAGATAGGCTAAGCGAGGAAATT
GGAACTGCCATGGCTTCTAACTATGCCCTCAGGAAGCAATATTCCTCCCACATCTTGATG
TTGTCCAGTGTCATAAATACCAAGCCAGAGAAGTCGGGAGACTAGTACCAAGGCAGATGG
GAGGCTGATGGGACTACCAATAAACTCAAATCCCTCCAGGCAAATAGCCACTCACTCTAT
CTCCTTTAAATTAGCTGTGCTTTGGATTTTGTTGGTTCTGTGACTTTGCTGTTTTTCTGG
ACAAGCAGGTCAGACGTCTGTCAGGGTCTTTACTTTTGCACATCCCAAGACATTTTCCTA
CTTAAAACATGGAGAAAATAAATGAACTTTCTTGGTGATGTCCTGGCGGGCAGCATTTGT
CTTTTTGCAGTAATACATTCCTATTTTACTGTAGGAGGTAAGCAGGAATAGAGGGCTAAT
CCTACCCCATTGAAACTGCACTGCACTTTATTCTTCTAAAAAAGTTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved