Oryctolagus_cuniculus Locus Mono:61:SNORD89
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:61:SNORD89
Oryctolagus_cuniculus
Mono:61:SNORD89
scaffold_211853
SNORD89
1001..1114
2114
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCCTGCTCTGTTTTAGAAAGTGATTAAATAAACTCACACCTTGCTGTCTCACTG
AAGAGATGGAAGTGAAGGAGCTGAGCCAGTAATTTTTTGAATGTGAAATTGTAGTCCTGT
GTTGCTTCTAAACTGGTTACTGTTTGTTGTGTAAGCAAGAACAAATGTTTACTGACAATT
TTTAAAATCATAAGAATTTATCCTTGTAGCTTATCTAGGATAAAAGGTTTATAAAACTTG
CTGTTATTTACTAAAATATTCAGTGTGTAAACAGTTTTGCCAGAATAAACTGTAGGAGCA
GATGCAATATGCGGAGCTTCAGAAATAGATTTGCCTTGCTTTGAGCTTCACAGGTTTCCA
CAATAACAGCTGTTGTCTTTGAAATCTGCCCTCTGCTCTTCAGTGAGAATGGAAAGTGCA
TCCTTGATTCTGCACCACGTGGGATGCTTGCTCTTTAACTTTTGAGAAGCTTCGAGGTGG
AAATGCTTTACTTAGTAGTTCCACTTGATAATTACAGAGGTGTGATGTTCATCAGCTGTC
AGTCACAGCTTCCTTTAATTCAGAAGTTTGAGCACTAAATTCTGAGAGGCTGGAATGACT
GTAATTTCCTCTAGAAACACAAGTAGCAGAATGAAGTCAGCAGAAGACTTCTCAGGACTT
TGTAATCAGTGTTTCTCCTTTGATAGTCTTTAACTTGGCAGTTGGTGGCCGCGCCGGCGG
TGAGCGTCCAGGGCAGTGAGGCTCGCTGTGGTTCCCTTGCCTGCCTGTCGTGCTTCTCGA
CTCCTCCCTGTCTTCACTCGCAGTGTGGGCTTCCAGCAGAAAACCACGAAGGGCCCGAGA
GGGGTGAACATGGGACACTGTGGGGCAGGTAAGCATTTGTGTTTGCATGCTTTTAGACAT
CCTGAACGTACAGCTTTTCCTAAAGAGTGCTTCCTGCAGCTACTGAGGAATGATGACAAT
AAAAGGCCGAATTGCAGTGTCTCCGTTAACAGTTGGCTCTCTGTGGGCACACGATGACAA
AATCTCCCGAAGCGAACCACCGGTCTGACCTCAGTAATGTCAGGAGTAGAGCTTCATGCT
TTTAGGAAAGCTTTCTAAGGGAAGTGGCCAACAAAGGCATTCCCGAAAAGCTAGGTTATT
TTTTTAACCAGAGAGACAGAGTACACACTCCCACCCACAGCCTCCCTCTCCAGATTCCCA
CAACAGCCAACGCTGGGCTAGAAACAGGAGCCAGAAACAGCAGTTCAGGTCTCCCAGATG
GTGGCAGGAACCAATTACTTGAGCCACCATCACTGCTTCCCAAAGTCCGTGCATTACAGG
AAGCTGGAGTCAAGAGCCAGAGCTGGGAATCAAATCCAGGCACAGCCAAACACCTGCCAT
GGTAATATTAAAAAAAATAATAAAAAAATAATCATTGACCCTTGGAAAACACTGGGGCTT
GAACAAGTAGTAAGCACCTCCCTGTGTTCTTTGAGGTTTGCTCACCTAAACAAAGGCTAC
TGGATTGGAAAAATAGACCTTCAAGAGTACCTGTGTGCCCATATGGATGGAACAGCCAGT
GTGACCAATCCCTAGTAAGGGAACTAAATTTGGCAGCAGTCTCTCTTGACCACATTAAAA
TGCATTGCTCAGGCCAGCGCCGCGGCTCACTAGGCTAATCCTCCACCTTGCGGCGCTGGC
ACACCGGGTTCTAGTCCCGGTCGGGGCGCCGGATTCTGTCCCGGTTGCCCCTCTTCCAGG
CCAGCTCTCTGCTATGGCCAGGGAGTGCAGTGGGAGGATGGCCCAAGTGCTTGGGCCCTG
CACCCCATGGGAGACCAGGATAAGTACCTGGGCTCCTGCCATCGGATCAGTGCCGGTGCG
CCAGCCGCGGCGGCCATTGGAGGGTGAACCAAGGGCCAAAGGAAGACCTTTCTCTCTGTC
TCTCTCTCTCACTATCCACTCTACCTGTCAAAAAAAATAAAATTAAAAAAATAAATGGTA
CATATCTTACCATACTTCTTTCACTCACATTTGGGAGTACTCGGTAATCTTGACTCTGCC
TACTCTGGCGCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved