Oryctolagus_cuniculus Locus Mono:132:SNORA31
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:132:SNORA31
Oryctolagus_cuniculus
Mono:132:SNORA31
scaffold_21284
SNORA31
1001..1122
2038
GCACGTGCTGCTGTGCCTGTCCTGTGCCTGTCCTGTCTGCTTTCACATCCAAAATCTGG
CCACGCTTCCAAGTTATGTCTGTTTTTCATATTAAACAGTTTTCTTTTGGCTTTAGATTC
ACATAGAGTTGTAAGAAATATGTCAGGAGGATCCATGAATTTTTTACTATTTGCCCCATA
CAGTCTCACCAAACTGTATTACAGGGTCCTGACCAGACTGCCCACACGGCTGCAGTCAGG
ATGCTGAATGCTCCCAACTCCCCTTCGCACCAGGACCACCACCCCCCCCCCCGCCGCCGC
CCTGAGGTAGCGTCAGCCACTCCCTCCTCACCCCCGCCTGCCCCAACTCCCAGCAAATGC
CAGTTTGCCATTCTCAGCTGCAGGTCTGCAACGGGGCCATTTGCAGGTGCTAAGGTTAAT
GGAAGTCGAGAATATGTTCCGTGGGGACTGGCTTGCTTCGACACAACCCTGCAGGTTTCT
CTCAACTGTCCGGGTCAGTAGTTCCTTCCCAGGGTGGGTGCTGTGCTGCAGCTGGCTAAG
CGGCAGCCCCTCTGGGTCCTGACTCCACTCCACTTCCCGTCCAGCTCCCTGCTAATGCGT
CCTGGGAGACAGCAGAGGATGGCTCAAGTGCTTGGGCCCCTGCCACCCAGGCAGGAAACT
CAGGAGTTCTGGGCTCCTGGCCTTGTCCTCGCTGTTGTGGGCATTTGGGGAATGAGCCAG
CAGATGGAGGTGCGCTCCTGCTCCCCACCCTCGTTGTGCCTTGCAAGTAGATGAAAACAC
TTAAACATATTAATAGCCTGTTCATTTTTATTGCCAAGTCGTAGTCCATGGTATAGATGG
GCAATGCAACTAACCATTTACTACCGGAAGGACATGTGCATTGCTCCTAGCCTGGGACTG
TTAATAAGGCTGCTACATTGTATCCACTGATAGACCTGGAACAATTAACTGTTCTTTTGG
TTTGCACTAGGATGCCAAAGAAAAAATCCCTGTACTGTCTGTCTTTGTGGCAGCCCAGAT
TGAATTGGGGAATACATTTGTAGGGAAAAAAAAAAAAAGGTGTTTGTTATCATTGAAAAT
GGAAATAAGAGGGCCGGCGCCGTGGCTCACTAGGCTAATCCTCCACCTAGTGGCGCCGGC
ACACCAGGTTCTAGTCCCGGTCGGGGCGCCGGGTACTGTCCCGGTTGCCCCTCTTCCAGG
CCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATGGCCCAAGTGCTTGGGCCCTGC
ACCCCATGGGAGACCAGGAGAAGTACCTGGCTCCTGCCATTGGATCAGTGCGGTGCGCCG
GCTGCAGCGCACCAGCTGCGGCGGCCATTAGAGGGTGAACCAATGGCAAAAGGAAGACCT
TTCTCTCTGTCTCTCTCTCTCTCTCTTCTCACTGTCCACTTTGCCTGTCAAAAAAAAAAA
AAAAAAAAGAAAGAAAAGAAAATGGAAATAAGAACATAGTGAAATGCCATTGTACACCCA
TTTGATAGAAGATTACAGTTCTAACAATACACTTGAGAGGATGTGGATCTGCACAAGATT
CCTTAAGTACTGCTAGTGGGTATAAACATTTTGCAAAACAGTCTGTCATTATCTTGGCGA
TGGAGCTTTCATATACTATATGATCCAGCAACTTCACACCTGCATACCCAAGAGGAAATA
ATTCCCATCTACCAGAAAACATGTACGTGGGTGTTTACGGCATCATTCATGTAGCACTTC
TGTTCCAGATAAACTACCACACTCACTGTACCCTGAGCAACCTGAGTGTATTGTCTTCCT
CATTCTCCTCTCTTATCTTCATACTCACCTGAAATGATTCCCCCCTCTTCTCCTTACCAA
GTTTTTCTCCATTTTTCTAGATACAGCTCAAGCTTCTTGAACTTATTTTGTAGGATTGGG
TACACACATATAATAGAGGCGGATTTTCATGAAGTTCTCCCTGTAAATAAACTGACCTTT
TGAAGATGATGGCATTGTTTCCCTCCGCCTCTACCCTTATTCTTCCCTGGTTTGGCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved