Oryctolagus_cuniculus Locus Poly:16:SNORD115
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:16:SNORD115
Oryctolagus_cuniculus
Poly:16:SNORD115
scaffold_185821
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 3275..3359, 5075..5155, 9892..9972, 11715..11794, 13088..13167, 15582..15662, 17325..17404, 19096..19175, 20809..20889, 22607..22686, 24323..24402, 28597..28677, 30289..30367, 32077..32157, 33902..33983, 35253..35333, 37952..38032, 39910..39990, 41697..41777, 43530..43610, 44452..44532, 46636..46716, 49891..49969, 51376..51456, 53160..53240, 54922..55002, 57168..57248, 61484..61564, 63663..63741, 65400..65480, 67168..67248, 68964..69044, 70794..70872, 75088..75170, 77186..77266, 78999..79076, 82380..82460, 83550..83630, 88126..88207, 89942..90022, 92195..92268, 94003..94080, 95794..95873
96873
TCGAATCCCCTGGTATGTTTCTAAGTCTACTGTTTGAGGTAAGTCAGCTTGAGCATGTC
CCGAATTGCACATCTCTTCCCTCTCTTATTCCCACTCTTACATTTAACAGTGATCACTTT
TCAGTTAAGTTTCAGCACTTAAGAAGAATTGTGTATTGATTACAGTATTCAACCAAAAGT
GTTAAGTAGAACAAACAAACAAAAATACTAAGAGGGATAACATATTAAGCTGCTCATCAA
CAGTCAGGGTGAGGGCTGATCAAGTCACCGTTTCTCATAGTGTTCATTTCACTTTAACAG
GTTTCCTTTTTGGTGCTCAGTTAGTTGTCACCTATCAAGGAGAACAAGTGGTATTTGTCC
CTTTGAGATTGGCTTATTTCACTCAGCATAATGTTTTCCAAATTCCTAACAGGGATCACT
TTTCAGTTAAAATTTAAACACCTAAGAATAATTGTGTGTTAATTACAGAGTTCAACCAAT
GGTACTAGAACAAAAAAAATACTAAAATGGATAAAGTATTACATTGTACATCAACCATCA
GGACAAGAGCTGATCAAGTCACTGTTTCTCATAGTGTCCATTTCACTTCAACAAGTTTCC
CCTTTGGTGCTCAGTTAATTGTCGCCAATCAGGGAGAACATATGATATTTGTCCCTTTGG
GACTGGCTTAATTCACTCAGCGTGATGATTTCCAGATGTCTCCATCTTGTTGCAATGACT
GAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGATGTCAACAGT
GTACCGTAAGCAAGGGTTGTGCCACAGATCAACACACCGATATCTGGTGGTGCCAGCCCC
ACAGGCAAAAGAAAAACCCTGAAGACCCTAGGTAAGCCAATCCATAGGAGCCCTGAAGAT
GAGATGGCGCAAAGGTTTTCCTGTGCTGTGGTTCCTGTGTTGGGGCAATGATGAGACCTC
ATACTGTCTTGGAGAGAGATGATGACTTAAAAATCATACTCAATAGGATTACGCTGAGGC
CCAGCCTAGTGACAGTGGTGTGCGATGACCCCAACATTCCCCTGCCCACCAGGGGAGGAG
ATCCTGGATACTGGAGACCTGGAGGCACTCTAGGCCAGGACATAGTCTGCAGACAGGAGC
ACCTGTATAGCAAGATATACCCAAGCTCCATCTTCCTTGGGCTTGATGTATACTCCCCAC
TGGCCAAGTTATGGGCCAAACTGGCACCTCCTTCCTCAGTTCTTTTACACAAGAGGGTAG
CCTCGGACAGTGCCCTTGAGTGAGCTTTGCCCTTTGTGATTTAATGCCCTGAATGCCTTA
CCTGAACCTTTGCCTTGAGTGGGGGCTCAGGCAAGGAATTACAAATGTTTCCTGTGAGAG
GGTTCATGTGGGGCCAGTGCTGCCACTTTTCCTAGGTGGGCCTCAGAAGCTCTTGGTTGC
TTGTTGCTGTGGGCAGAAGTGGGTAGACACTGGGGAACCAGTGGGAGTGGGTTTAGGATT
GATGGATTCCTGGCCAAAATCACACCAAGTCAGGAAAGGTGGTTTGGAGGAGGAGGCACC
ATTCAGGTGATGTTCAGCTCAGGACCTTCAAGTGGGTGGCAAGGCCACTGGAGCCTAAGT
TGCAGGGACCCCTAGGCTGGTAGCATAACATCTGCAGGGTGGTGCCAGGCATGCCCATCC
CTGTCCCTTTTCTAGTCCAGCACCTGGTGTTCTTAGCCCACATGGATGGACATGGGGTAT
GTTGAGCCAAACACAGATGACAGGGAACCTCTTGGCCCGTAGGATCCCCTGCTCCATAGG
AGGCACCAAGACCCCACAGTAGGAGTCGGCCATTTTTCAGCCTAATGCCCATTCCCCATC
TTTGGGATGTATCAGCACTTGGTTAGGCAGCGCCCATAGGAGGAAGCTGTATCAGTCTGG
GGATTAGACCTTTGTGCAGGGCTGGCTCTCAGATCCTATAGAAGACCCTGAACAAGGACT
GCATAAGAGGCCCAGGTGAACGACAACACAGAGCACTGAGAAAATGTTGGTGAGGCAGCC
AGATCTGCAGGTGACTTGCAGCCTGGGAGCTTCATGTGGGTTGCAGGGTTCCTGAACCCT
TGTGTACAGGGGTATTTGGTTGATGCCCAGCCAGAGGGGTACCAACACTCTGACCAGGGC
ACCTGCTTGGTGCTTCCCAGCATGCCCATCTCCAGTGCTTGCCTTGTCAAGGGCCTGCTT
TTCCCTTCACACATGAGTGGACTTCAGGCTTAGAGGAGCCTGGTAAGGATGCCAGAGCCC
CTCCTGGTTCCAGGATCCTGCTCTCAATGGAGGCACCAAGGCCCTGGAAAGAAGTGAGCC
ATGGTCCAGCCCGATGTTCATGCCACAACTTTGGAATGTGTACAGAACTGAGGTGGACAG
TGACCATAGGATGTTTGTGTCTCCATGGGGCAGAGCTTGAGCTCTGAGCTCCAGTGTTTT
GGTGCAGCATACAACTGAGCAAGTATCTGGGCCCATATGACAACACCATGTTGTTTGCCC
AAGGCCCAGAGGGGACTTCCTTATGAATGTCTCATAGAACTGTAATACTAATGCTTAGGC
CAGGCTATTGCTTGCTTGTCCAGTCCAGTTTCAGGCCAGAACCAGATTCTCATGTGCAGG
AAGGATTGGTAGAGTAAGCTGCTTCCATCAGGACTAGACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCCTCTGTATGGTGTACAAGAGGCCCATTTGGCAGAAAACTCAGCAGAGTGTTC
CTGACCCACTGTGCCCACAATGGTGGGCTCCTGGAAAGCCTCACTTGGGCCAATGAGGCC
AGCACATTCTGAATTCAGTGAATCCTAGCCTGTTACTGCTGTCTGTTCACACTCATTCAC
AACCCTGTAACACAGTTGATGTTACCAAAGAAAGACCCTATGGGGTGCAGTGCCCCTGGG
GCAAGGACTTGGTCAAGGCCCTAGCATCCAATGAGCTGGTGTTGCCAGCCCTGTAGGACA
AGGCAATGACCAGCACTGCCCATGGTACACCAGTCCATCCATACCCTAGAGCTGGGATGG
CACATAGGCCTTCCTGTGTGGTGATACCTGGGGTTGGGTCAATTTCGGATGAAACCTCAT
ACTGACCTGAAGAGATATGATGACTGAAAAATCATGCTCAATAAGATTACGCTGAGGCCC
AGCCTAGCGAAAGTGGTGAAGAGAACCTTGGAGTAACCAGTTGCATAACAGGGGAGGAGA
ACCTGGGCACTAGAGATCTGGAGAACCCCAAGCAAGTGTGTGGTCCACAGGCAGAGCAGC
TGCTCATTCAGGATGAATATAAGCTCTTATGTTCCTTGGGTTTGGTGTGTGCTTCCCCCT
GGTGAAGATGAAGGGCCACAGTGGGCTCCTATCTCATCTCCATTCTTCTCTTCTATATTT
CAGTGAGTAGAGTAGCCTGGAGAAGTAGCCTTTCAACCTGGGTCATAGGTAAGTGGATGG
TGGTGGTAATGGGGCCTCTGTGAGGCAACAGGGATTCTGTAGGGTCACAGACATGAACTT
CAAGGGTAACCCACGGAGACATGGAGACACAGAAAGGCAGCCTTGGGCAGTTATCCTGAG
TGAGCTGTGCCCCTTTTGGCTCTGAGGTGCAGAATGCCTTACATGAACCCTGCCTTGTGT
GGGGGCTCAGGCAAGGAAAGAAAGCATTTCCCAAAAGAGGGTTCACATGGGGCCAGTGCT
TCTGTTCAACCTAAGAGGGCTCAGCAGCACTGGGATGCCTAGCTGATATGGGCGGAAGTG
GCCAGGCCTCAGGGAACCAGCCTCCATGGGGGCGGGAGCAGGGACAGGTTTTAGATTCAG
TGGGGCCCGGGCTCAAGACCACATCAAGGCAGAGAGGGGGTTTTGGAGGGGCAGAGACTC
TGCAGATGACTGTCAGCCTGGGAAATTCACATGGGTAACAGGGCAATTGGATCCTAGGAC
ATAGAGATGATCAGTCTGGTTCCTATTTAGGAAATGCCAATATACATACTATGGCACATT
CATGGTAGTGCCAGACACACCCATCTCCCTTGTTTACCTGGTACAGGGGATGGTATTCTC
AGGCCACATGGGTGGCCTCAGACTAATTGAATCCAGCAAGCATAACAAGGATCCTCTAGC
CTTGGGCTCCCATTGCTCCATGGGAGGTACCAAGTTCCCACAGTAGAGCTGGAGTATGGT
GCATCCTAATGCCCATACCCTATCTTTGGGATATGTACAGACCTGAGTTGGGCAGCAACC
ACAGGAAGTAGGTGTATCTGACAAGCTCAGTATGAATTCTGAAGATACAGTTTGTGCATG
TAACCTAGACCTGAGCCCTCAGGCCTGGTTGGAACACCATGTTGTTAACCCCAGGTCCCC
ACAGTGGCCTCCTTGGATGTCTCATTCATTCAGTCCTTAGGCCAACTATGTTCCATTGCT
TGGTTGTCTAGCCTGTTTCCCTGCTGGAACCTGACTGTTGAGGTAATATTGGCGCAATAG
AGGATGCTCGCTCTGTGACCAAGAGGCCCAGTAGTTCTTAGGTAAGGTGGGCTGATTTTG
CCAATACCACCATGCTTACAGGTGTGGGATCCTAGGAGGGCTCAAAAGGGCCAATAGGGT
CAAAGCAAGCTCTGGAAGTTGTATGCCTAGAGCGTTCCTCTGTTGCCTGTTCATACATGG
CCCCTACCGGTTCCACAGATGATGTCAGCAGAAAAGCAATCCATGGATACTAGTACCCGT
TGGCAAGGGCTGTGGTCAAGGCCCAGCTTCCAATGAGTTGATGCTGCCATCCCTCTTGGA
CAAGGAAACAACAGACTTCCAGAGGTAAGCCAATTTATCTGGGCTCTGGGAGTTGGATGA
CACCATGAGATTCCCATGGAATGGTCCCTGGGGTTGGGTCGATGATGAGACCTCATTCTG
TCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCC
TAGAGACAGTGATGCAAGAGGACCCCAGGTTCCACATGTGCTTTCTAGTGGTAAAGAACC
TGGTTACTGGAGACCTCAAGACCCAGAGGCAGGAGGCAGTGCCCAGGCAGGAATGGCTGA
CCCTAGAGGATCCAACTAAGCTTCTTCCTCCTTGGCTTGGTGTGTGCTCTCCTCACATTC
AGTTATGGTGCATCGTTCTTCAGCTCCCTTTATCCCCTTGTCTCTTTCAGTGAGATGTAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATCCATTTTTGTTAGGTT
TCCCTGTTTGCTCGGCTATACAAGTCCTTGTAGTAATTTCTGATGATTCTTTTTATTTCT
GTGGTGTCTGTTGTTACGTTTCCTTTTTCATCTCTGATTTTATTGATTTGGGTCTTTTCT
TTTTGTAGTTAGTTGGGCCAATGGGGTGTCAATTTTGTTTATTTTTTCAAAAAACCAGCT
CTTCGTTTGACTGATTTTTTGTAATGTTTTTTTGGATTCAATCCTGTTAATGTCTTCTCT
GATTTTAATTATTTCTTTTCTCCTACTAGATTTGGGTCTGGTTTGCTGTAGATTTTCTAG
GTCCTTGAGGTGAATTGAAAGCTCAATTTTCAATTTCTTGATGTAGGCACCTATTGCTAT
AAACTTGCCTCTCAATACTGCTTTTGCCGTATCCCATAAGTTTTTTTTTTTATCTTTTAT
TTAATGAATATAAATTTCCAAAGTACGACTCATGGGTTACAATGGCTTTCCCCCCCATAC
CGTCCCTCCCACCCACAACCCTCCCCTTTCCCACTCCCTCTCCCCTTCCATTCACATCAA
GATTCATTTTCGATTATCTTAATATACAGAAGATCAGCTTAGTATACCTTAAGTAAGGAT
TTCAACAGTTTGTTCCCACACAGAAACATAAAGTGAAAAATAATAGATGATTTGTTTTTA
AATGATGATGAAATCAGATCAGACCTATTGTCATGTTTAATCCCAGTGAGAGTCAAGTTG
GGAATTGATAATTTCTTTTTTTTTTTTTTTTTTTTTACAGAAGATCAGTTTAGTGTACAT
TAAGTAAAGATTTCAATCGTTTGCACCCCCATAGAAACACAAAGTGAAATATACTGTTTG
AGTACTCGTTACAGCATTAAGCCTCAGTGTACAGCACATTAAGGACAGAGATCCTACATG
AGGAGTAAGTGCACAGTGAATCCTGTTGTTGACTTTACAAATTGACACTCCTGTTTATGG
CATCAGTAATCTCCCTATGCACCAGTCATGAGTTTCCAAGGCTATGGAAGCCCCTTGAGT
TCTCCGACTCTTATCTTGTTTAGACACGGTCTTAGTCAAAGTGGAGGTTCTCTCCTCCCT
TCAGAGAAAGGCACCTCCCTCTTTGAAGACCTGTTCTTTCCACTGGGATCTCACTCACAG
AGATCTTTTTGCCAGAGTGTCTTGGCTTTCCATGCCTGAAATACTCTCATGGGCTTTTCA
GCCAGATCCGAGTGCCTTTAGGGCTGATTCTGAGGCCAGAGTGCTATTTAGGACATCCGC
CATTCTATGAGTCTGCTGAGTATCTCACTTCCCATGTTGGATCACTCTCCCCTTTATTTG
TTCTATCGGTTAGTGTTAGCAGATACTAGACTTGTTTATGTGCTCCATTTGACTCTTAGT
CCTTTCATTATGATCAATTGTGAACTGAAATTGATCACTTGGAATAGTGAGATGGCATTG
GCACATGCCACCTTGATGGGATTGAATTGGAATCCCCTGGTATGTTTCCAACTCTACCAA
TTGGGGCAAGTCAGCCCGAGCATGCCCCAAATTATACATCTCTTCCCTCTCTTATTCCCA
CTCTTATGTTTAACAGGGATCACATTTCAGTTAATTTTCAACACTTAAGAATAACTGTGT
GATAATTACAGGAGTTGTGGGGATTTTCTAGGGGGGCTCCTTCTTCAGGCCACTTTGTCT
CCTTGTTTTTCTTTTTCAGTGAGATGTACTAGGCTGGTGGGTCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGAACATCAGGGTCTTTATGTGCTTTCCA
GTGCAAGAGACACTGTGGAACATAGACCCGAAAACCCCCAGGCTGGAAAAACATCCCAGG
CAGCAAATGCTGCTGCTGTGGATCTACCAAAGTTTCTTTTAGTAAGGGTGTGTTCCCTAT
GGGCTGAATTGTGGTGCTGGACTGGGGCTTCTTCTTCAGCTCCTTTCATCCTCTTGTGCC
TTTCAGTGAGATGTGCTGCCCGTCAGGACACCCTTGTATCCCACATCCCAGGTGAGTGTA
CGGTGAGGATCATGGAGCCTCTGGGCAGTATCTGGGCGTCAGATCACCTGTCACAGCACA
GGATGTGGACCTATGGTGAAAAAGGATGGACACCTCTGACTGTGCTCCAGAGCCGGCTAT
GCCCCTATGGACTTTGAAATCCAGAACACATTGCCTTAAACACTGGCCTGGTTGTGCTGA
GGGTTGGGAATGGATCCTGGGGAAGGGTTTAGTGAGGCTATTTGCCCCCAGTTCTCCTAT
GTGTGCTGCAGTGGGTATGCATTGCCTTGATCTTTTATCTAAGAGTGAGCAAAATTCAGT
ATCAGATATCTTTGTCGGAGACTGGCTCAGATTCTGTTGGAAGCATGGGAAGGGGATAAA
ACCCATCATGAGGGAGGGTTGATGGGAGAGCCTACTCTTCAGGTGCCTGGTAGCTAGGAA
GCTTCACATGCCTGGTAACATGGTAGCTGAATACTAAGACACAGCACCATCAGGCAGTAT
CCAGTCTGGGGATTCGGACACTTAGCCTAGGTCACCTGAATGGTGGTGCCAAGCTTGTCC
CATGCCTGGCACTTGCCTCATCCAGGGATCAGCTTTCCTTCTCACATGGGTGAGCTTTGA
ACCGAGGTGAACTTATAAGGACATGGGGTCTGTCTTGGTCCCGCCATCCACTTCTCCATG
AGACGCACCAAAGCCCCACAAACGAAGGATCCATGTCTGGGCTGATGCCCCTTCCCCATG
TTTAGGATATGTCCAGGACTGCTGAGTACAGACACCATGGGAGGAAGGTATCTTGGAGTA
CATAGCTGGAGAGCCTGGGAAGCAGGTTGTATTCACACCCACTACCTTAACACACAGGCC
TGGCCTGGATAGGAATGCTGAGTGAGTCATGGAAAAACCCCACCAAGGCTTCCTGTGATG
CATCTTATGCCATCGGTTCTTTGATATCAGGTGCATGCAAGCACCTTCTAGTCCTTACCA
GGTCTTGAGCCAGATTTGCGATCGAGGTAAGAAGGGATTTGGTGTTAGCCACTTCCAGCA
TGGTGACACAGTCTGACTTGCTCTCTCTGACCCTGTGACCAAGAAGCCCAAAAGTTTCAG
GCAATGAAGTTGTAGCCTGTGCAAACCAAGATGTCCACAGAGGCAGCCTCCTGGAAACCT
CACCTGGACTGATTAGAGTCAAAGCATGCTTGAGAGTCAGTGTACTATAGCCTGATCCTA
CTGTCTGTTTACTCCCAACCTGCTCCATGTGCACAGATGGTGTCAGCAGAAGAACCCCCA
TGGAGAACAGACCAAATTCAAGAACTGTGGACAAGGTGCCAGCAGCCAATGAACTGGCGA
TGCCAGCCTTGTTGAAGAAGGAATCATCCAGGACTGCCTGAGGTAAGCCAATATTAATAG
GCACTATCAGTGGGATGGCTTTCAGAGGTCTTGTTGTTTGTTTCTATGGGTTGGGTCAAT
GATGAGACTTCATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGAT
TACGCTGAGGCCCAGCCTAGTGACAGTGGTGCAAGAGGACCTTGGGGTAACCAGGTGTCT
TCTAGGTGAGGATTGCTGGGGACTGAAGACTACAAGGTCTCATATGCCAGCACACAGTAC
CCAGACTGGAGCAGCTGCTCATGCAGAGTGCACCATGCTCCATCTTCCTTGGGTTTGTTG
TGTGTTCCCTGCTGTCTGAGTTGCAAGACCATGCTTAGGGCTCCTTCTTAGATCGTTTCA
TCCTCTTCTGTCTTTCAGTGCGAGGAGCTGCACAATGGGGAACAGTTACACCCCAGTTTC
CAGGTGAGTGGATAGAGGGTGTCCATTGGCCTGTGTCTGGCAGTAGGGGTTTTGGTGGGT
CACCAGACTTGAGCCTCTGGGCTGGACACATGGAGACACAAAAAGGCAGACTTGGGCAGT
TTTTGAGTGAGCGCCTTTAGGTTGATATCCTGAAGAACTTACATGTAGAGGCCCATGGTT
GCCTTGCTCTTGTGGCTGTAAGTGTGCCAACACTAGGGACCAGGCAACTGTTTGATGGCA
GGGCTCAGATCCAAAATAAGGCCCATACAGACAAACATACCAAGCAGTCAGTGAGTTTCA
TGGAGCAACTGGCTCTGTAGGTGTCTGGTAGCCAGGGAGCTTCACTTGTCTCACAAGGCC
ACTGGAGCCTAGGGCCCATGAACCCTCAACCCAGTGTCTTTTCAGAGAGGAACCAATACC
AGAGCCATGGCACCTGCAGAGTGGTGCTAGTCACACCAAATTTCTTCTCTTTGCCTTCTC
TAGGTGCTGGCATTCAATGGCCACATTAATGGGCTTGGACTGTGTTGGGCCTGTTAAGAT
TGCCAGTGCAACTCCTGGGTCTGGGCTCCTACTCCTCCATCGTTGACATCAAGGCTGCAA
TATATAAATGTGCCATGGCCCAGCCTGTGGTCACTTACTCATTATTCAGATGTGTTGATC
CTGTGTTTTTCAGTAACAATAGTAAGAAGTTGTTTTTGCAGGCAGGCACAGCCTGATCTC
TCAGGATACATTGTGCTCTCACAGCCTGTACCAAAGCACACAAGCTAGTAAAGCAACCCT
GTTTTAGTATGCTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCT
GCCCTACGAATTACCCGGGGTATGTCTTATGTAGCAAGTATTCCAGTGCTTAGATTGAGA
AATTGCTCACTTGACTAGCCTGGTTCTGGCATGGATGTACATTTTGGTGGCAAAAAAGAT
TTGTGGATTTAATCATTGCTATTCAAAAAGATCCTACCAGAGTGTGTGTCTCTCTTTCCC
TCTGAACAGGCCCCACAGTTTTGGATGACATGGGCAGAACTTGCCAGTCCCCACCCCAGC
TATAGAATGGCCTGCTAGGAGAACTCACCTGGGCCAATGAAGCCAAAGTACGCTGAAGAA
CCAGCACACCCTTGCCTGGCCCTGCTGCCTTTTCACCCCCATTTACTTCCTTTTTCCACA
GATGTCAGTAGAGGAAATCAAGGGGGCCCAGTGCCATGGGGACAAGGGCTCTGGTCTACA
TCTAGTTGCACATTAGCTGGGGGTGTCATCCCCATAGATGTAGGAAATGTCTGGGACTGT
CCAAGTACACCAAAAAATCCAGGCCCCTGAGTTGGTGTGTATCTAGGAGCTACTCTTGTT
GTGATTCCTGGGTTTGGGTTAATGATGAGACTTCACACTGTCTCAAAGTATCTTAGTGAC
TAAAATTCATGCTCAATAGGATTGTACTGAGGCCCATCCAAGTGATAGTCAGTCACGAGT
ATTCCAGGGTGCACATGTGCCTTCCAGGGTAAGAAGCTGGGTATTGGACACCAGGAGGCT
TCCCAGGATAGGTTTAGTCCTCAGGCTTGAGTGGCTGCTCCTGCTGGAGTCATCCTAGCT
CCTTCCTCTTTGAACTTGGTGTGTGCTCTCTACTGGCCATGTTGTAGGTCATGCTCAGTC
TCTTCTTCAGCTCCCTTTGCTCCTGTGGTCTTTCAGTGAGGTATGTTTCCTGACAGGTAC
TATAATTTCCAAAGCACTTTCTTGGTGTGAATGTAGGTGGGCAGACAATAGGGATATGGC
TTCTGTGTGTGGGAAGGCCTTAGTTCCTCTATATGGCCCCTATGGATGGTCACACCAAGT
GAAATAGTTTGGTGGAGCAGCTGGATCTGCAGATATCTGGTATCTTCATGTGGGTCACAA
GGCCATTGGAGTCTAGTACCTAGGAGCTCTCAGTTTGGTGCCTGGTGTGGTAGTATAAGC
ACTTAGGCCATAGCATTTGTAGCATGGTTCCAGGGACACACTTTTCTACCCCTTGAATTT
TCTATGTGCTGGGGTTCATGGGCCATAAGGAATGACTCAGACTGAAATTGGGCCTATCAA
AGATGCCAGTGTACCTTCTGGAACCCATGTTCCCACTCCTCCATGGTAGACACCAAGGCT
CCACGGTAGAGTTGTCCATGGTTCATCCTAATTGTTCTATACCATCTTTGGTGTGTATAT
CATACTGAGATGGGCAGTGACCATAAGCTGAATGTTTCTCTGGGTGGCACAGCTTGAGAC
CCAGAATCTACTGTTCATGTACATCCTGCAACAAGTTGCTCAGGCCCATACAGTGACCCT
GACTTGATAGGCCCAGGGCACTGCAGGTGTCTCCTTAGATATATCCAGTCTTCTGATACT
TAGGCTGAACCATTACCTGCTTGTTCAGCACAATTCCGTATAGGACCTGGATGTTAGGGG
CAGGAAGTATGATGGAAGGCGCCATTTCTGGCAGGACACTCCTGTCCAAGTATCCCTTTC
TGTTCTAGTAACCTAGAAGCTCAGCAATTTGCTAAACACTACCACGCCTACAGGGTTAGA
CTCCTGGAACTACTCATCTGATCTGATGAGGTCAAATCATGTTCTGGAATCTTTGCAGCC
TAATACGGGCCTGTTCTCTGTTCACTCCTGACTAAATGACCAATACTGCCCATGGTAAGC
CAATCCATCCATCCTTGCCATATGTTGTGATGGCTCCAGGGACTCCTCCTGCTGTGTTCA
CTGGGGTTGGGTATATGATGAGATAACAGAATGTCTCAAAGAGAGATGATGACTTAAAAT
CATGCTCAATAGGATTACTCTAAGGCCTCACATAGTTACAGGGTGCCAGGAGTACCCTAG
AGTCCACAAGTGCCTTTCAGGGTAGACCCATAGGAATGCACACCTGGAGGCTACCCCAGT
CCTGAATGTAGTCCCTAGGAAAGAGTCTTTGATCCTGATGAATCCAATCAAGCTATTTCC
TCCTTGGATGTGGTGTGTTATCCCAACTTGCCAAGTTATGGGTATATTTTGTGGGGCTCC
TTCTTCATCTCCCTTCATCCTCTTTTTTCTTCCAAGAGATGTAGAACCCAGTGGGTCACA
CTTGCATCCTCGTTCCCAGGTGAGTGCATGGCATGGGTCTTGTGTGGTGGAGTTGGGTAT
CATGGCCGGTCACTCAATGCAAAAGTTAGGAATGTACTCAGGGAGACATCAGAATGCAAC
CTGGGGCTATGATCCTGAGTGAGCTGTCTCTCTTTGGGCTCTGAGGTCCTGAATACCTTA
CCTGAATCCCCAGAAATGTGTGTGTACCTGGAAAGGAATGAAAACTGTTCCTGAGGGAGG
ATCATGTGCTTTCTTGCTTGCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTTTTTTTGACAGGCAGAGTGGACAGTGAGAGAGAGACAGACAGAGAGAA
AGGTCTTCCTTTGTCGTTGGTTCACCCTCCAATGGCCGCCGCGGCCGGCGCGCTGCAGCC
GGCGCACCGCGCTGATGGATCATGTGCTTTCGAAGTTGCCACTGCTCCTATGGGGCTATA
TAACATCTCTGTGTTGCCTGTTGGTGTAACCAGCAGTATTAAGACACGAGGGATCTGGCG
TTCTGAAGGTGCAGGTTCAGCTTCCTTAAGAGGTCTGGTTTGAGGATCAATTTGAGAATA
GGAGGGAATTTGGCCAGGCTGCCAGCTATGCAGGTTTCTAGCAGCCTGGGATCTACAACC
GGGTTGCAGGGCCCCTAGAACCTAGCACACAGAAATGATCAGTTTGATGACCAATGAGGG
AAGCGGAGGCATCTGTGCTATGGTAGCTGCAGGGCCATAGTCCAGCCCAATGCCTTGCCC
CAACTGTGGGATGTGCATGCAACTCAGTAGGCAGTGTCCTTGGGGGAAATTTTCTTTGGA
TCCGTAGCCTGAATTCATGGGTTCCAGTGTGTGATCAGAGCTTGCACCTGAGCCCCTAGG
TCTGGACAAGGATACAATCTTGGTAGGACCAGAGCTGTTCTGGGGACTCCTTTGGTAAGA
CCCTTGACACCACTCTTCTGAGCTGTGCCAGTGCAAGAATGTTCAGCCAGACTAAAGGCA
CAAATAGTTCTCTGGGGAGGAAAGGGTTTTGGGACTCCCACGGGAGTGCATGGCAGGGAC
TATGGGGTCTTTGTTAGGAAATAGATTGTCACAGCGGATCAGCCAATGAAAGCTAACTTG
TGGCCTGGGTTTGGGCCCAATTAAGAGATACCAAAGTTCCTGGGGGTGGTTCACATTTGG
CCAGTGCCCATGTTTGTTCTAGGTGAGCTGGAGAGCCTCTGAGTTGTCTTGTCTGATATG
TTGGAAGTTCTTGACTTCTGGGTGTCCAACCACAGTGTGAGTGCTGGGTTTAGATTTCAA
GGAGGCCAGCGCCACGGCTCAATAGACTAATCCTCCACCTAGCGGCGCCGGCACACCGGG
TTCTAGTCCCAGTTGGGGCGCCGGATTCTGTCCCATTTTCCCCTCTTCCAGGCCAGCTCT
CTACTGTGGCCCGGGAGTGCAGTGGAGGATGGCCCAGGTGCTTGGGCCCTGCACCCCATG
GGAGACCAGGATATGCACCTGGCTCCTGCCTTCAGATCAGCGCGGTGCGCCAGCCACAGC
ACGCCGGCCTCGGCGGCCATTGGAGGGTAAACCAACGGTGAAGGGAAGACCTTTCTCTCT
GTCCCTCTCTCTCTCACTGTCCACTCTGCCTGTAAAAAAAAAAAAGATTTCAAGGAGGCC
TTGGATGAAGATTGGATGAAGACACAAAAGGTAGGGATAGGGGTTTTGTGGGGTACCAGG
CTGTGCATATGCCTGGCTGCCTGGGAGGTTTATAGGGGTCAAAAGTTCTCAGGAAAGGTG
GCATAGCTTTTCCAACCCCACACACCTATAGGGGTGGCCTCATGGTAGGCCTCACCTAGG
CCAATGGGGACAGTGTATGCTGGGGAACCAATGCATCCTTACCTGCACCAGCTGTGTGTT
CACACGTGCCTCCTCCTAGTCCCACAGATGATGTCACCAGATGAAACATACATGTGTTTC
AGTGTCCCAGAAGCAAGAGCTGTGGTCATGAACCCAACAGCCCACGAGCTCATCCTGCCT
GCATTGTTGGAAAATATCTGCAACTGCCTGTGGTAAGCCAGAAACCTGAGCCTTGGAGTT
GGGATGGTGCCGGGGTATCCCTGTGCTGTGGTTTGTGGGGTTGGGTCGATGATGATACCT
CATACTGTCTCGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGG
CCCAGCCTAGTGACAGTGGTTCGTAGGGTCTTGGGGTAACCAGATGCCTTCCAGGGGAGG
GGACTCTGGTGGCTGTAGAACTCAAGGACCCCCATGGGAGGAAGTGACCTGCAGGCAGAA
TCAGCTTGTGCAGGATTCATAAAAACTCTATCCTCATGGGGTTTGTTATTTGATCCCTGC
CGTAAAATTTGCTGTCCTACACTGAGTGCTCCACCCTCCTCTCCTATATCTAAAACTGTC
TTTCAGTGAGATGAGCTGCCCTATGGAGCAACCTTGAACCAAGGGTTCTAGGTGAGTGGA
TGGAGGTTGTAATTGGGCCTTTGTGGGACAGTGAGTACTCTGGTCATGTCATCCCAAGAG
TGTGATGGGAGGAACCGCGGAGGGGGCAGGAAGGCAGCCTTGAGCCATGGTCTTTAGTGA
GCGATGAAACTTTGGACTCTGAGGTGCAGATCAATGGACTTAAATCCCTTGCCTGGTGAG
GGTGCCAAATAAAGAGTTTATATACTTCTGAACAAAGGGACACATTGGGGCAGTGCTACC
GCTGGTTCTCATTGGGTTACAGCACATCTTGGTTGACTTGAAGGTGTGGAAAGATGTTGG
AAAACACTAATAATAAGGCCACTGGCCAGGGACAGGGATGAGATTCACAAGAAGACCCAG
GCAAGATCACACTAAGGCAGTAAGGGAGAGTTGATCATTCAGCCAGGTCTGCAGGTGCCA
GGCAGCCTGGGAGTTTTATGTGGGCCGTGGTTCCACTGTGCTATGCTGCAGGGATCTCTG
AGCTGTGCCTGGTCAGAGAGGTTCTACAAGTGATTCATAGCACATAAAAGTTGATGCCAT
GCATTCCATATAGCTGCTGCTTGCCTGGTCCAGTGGCTGGCATTTGCAGGCCACGTATAT
GTGTTTTGGACTAACCTGAGCCCACCAAGGATGCCAGGGCCTTCACTGAGCCTGGGGTTC
TGTTCCTCAACAGTACACACAAAAGCCACATGGGCCATGGTCCCACCCAATGCACATAAC
CCATCATGGGGATGTGTTCGGGAATTAGTTGGGCAGTAACCAGAGGAGGGCAGTGTCTAC
ATGGGGCCCAGCCTTTCCTCTGAGGATACAGTGCATTCAGACATCCCCATATGAGCTCCT
GAAGATGTGAGGCAACAATGTATTGGTAGGTCCAGGAACCACAGTTTTATGTTTTGGGAT
TTTGAACTACGGTTATTACTATGCTTGCTTGTCCAGTCCCATTTCCAGCCAGGACCTGTG
TCTTTCGGCTTGCAGGAACAATGGTGGAAACTACCTCCAATACTACGTTTCTGGCCTAAT
AGGCCTCTCAGTCACATAGACCAAGCACACCTAGAGAGGTAGGAACCTGAAAACCTCATC
TGGGATGATGGTGGCCTAAGCATGCTCTGGATCCGTGTATCCTATTATGCTGCTGCTGTA
GTTCACACCCAATCACCTCCCTATCCCACAGATAGTGTCACCAATGGAAGCCCCTACGAG
GTCCAGTTTGTGGAGCAAGGGCCGTGATCAAGGGCCATGAGCAATCAAGCTTGTTCCATC
ACCAAGAGAGAATGAAATGTCTCTGACTTCCTGAGGTACGTCAATCCTATGGGCTGTAGT
GTTAGGGCAGTGATAATGGGATTCCATTGTATGGTTCCTCTGGTTGGGTCAATGATGAGA
CCTCATACTGTCTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGA
GGCCCAGCCTAGTGACAGTGGTGCAGGAGGACAGCAGGGTCCCTATGTGCTTTCCCATGC
AAGAGACACTGTGGAACTTAGGCACCCAACTGGGAAAACGTCCCAGGCAGCAGATCTGCT
CCCGCGGGATCTACCAAAGTTTTTTCCTCCTTGGCAAGGGTGTGTTCCCCATGGGCTGAA
TTGTGGTGCTGGACTGGGGCTCCATCTTCAGCTCCTTTCATCCTCTTGTGCCTTTCAGTG
AGATGTGCTGCCCATCAGAACTCCCTTGTATCCCACATCCCAGGTGAGTGTACAGTGAGG
ATCATGGGGCCTCTGGGCAGTATCTGGGGGTCAGAGCACCTGTCACAAGCACAGGAAGTG
GACCTATGGTGAAAAGGGTGGCTACCTCTGACTGTACTCCAGAGCCATTTGTGTCCCTTC
GGACTCTTTGTTCCAGAACATCCTACATGAACTGCTGGCTCGGTTTGGGGGCCAAGAGAA
GGTTGGCAGTGGATCCTAGGGAAGGGTTTATTTGTGGCCATTGGCACCACTTCTCCTAAG
TGGGCTGCAATGGCTCTGCATTGCCTTGCTTTTTTGGCTAGGTGTGGGCTTTATTTGGGA
TCAAGAGTCTTTTGAAGGAGTGGCTCTGACTATGTTGGATGCCTGGGCAGATGACCACAA
ACATCAGTGAGAGGCATTTGGTGGGAGAGCTAGCTTTGCAGGTGCCTGGCAGCATGGTAG
CTTCACATGCCAGGCAACATGGTAGCTGCATACTAGGACAAAGCACCATCAGGCAGTATC
CAGTCAGGGGGATTCAGACACCTATCTCAGGTCACCTGTATGGCGGTGCCCTGCATGCCC
CATCCCTGGCACTTGCCTCATTAAATGGGACAGCATTCCCTTTCACAAGAGTTAGCTTTG
ACTGAGTTGAACATATTAAGGATACAGAGTTCGTCCTGGTCCAGGGCTCCCACTCCTCCA
TGAGTTTTGCCAATTCCCATAAACAAAGGATCCATGTTCTAGGCCGATGCCCCTTCCCAA
TCTTTAGGATGTGCACAGGACTGCAGTGGGCAGAGATCATGGGAAGAAGGTGTCTCTGGA
GTGTATAGCAGGAGATCCCAACATGAAGGTTTTGTCTACCAGCCTTTACCATAGTTCACA
GGCCTGGCCTGGACAGTAATGCCATATTGGTAGTCACAAGGCCCCCCAGGGTTCCTGTGA
TGCATCTAATGCCATCAGTTCCCTAATATCAAGTCTATGCCAGCTCTTTCTAGTCCAACC
CAGTCCCAGGCTAGAATTGGGCACAAGAGAAGGGGAGTGGGGTTAGCCGTGTCCAGCATG
GTGACACAATCTGAGTTGCCTTCTCCAGTCCTGTGACCAACAGACCCAGAAATTTCAGGC
AAGGTGCACAGAGCCTGCCCAAACCATGATGCCTATAAGGGCAGTCTCCTGGAAGCTTCA
CCTGGGCTGTCAGGGCCAAAGCAAGCTTGAGAGCCAGTGAACCCTAGCCTGTTCCTGCTC
TATGTTCACATCCAAACCCCTCCTTGTTCACAGATGTCAGCAGAGGAATCCCTGTGGACA
AGGTGCCAGCAGCCTTTGAGCTGTTGATGCTAGCCATGAAGAAGGAAATGTCCAGGACTT
CCAGAGGAAAGCCAGTCCTAACAGCGTTATCGGTGGGAGGGCTCACAGAGATTCTTGAGG
TGTGTTTCCTGGGGTTGGTTTGATGATGAGACCTCATACTGTCTCGAAGAGAGATGATGA
CTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGTGACAGTAGTACAAGAG
GAATTTGGTGTAAACAGGTGCCTTCCAGGGGAGGAGACCCTGGGGATTGGAGAACTCAAG
GCCCCTCTTGAAAGGCTGTGATCTTCAGGCATGATCGGCTACTTTTGCAGGAGTCACATG
AACTCTACCCTCATTGGGTTTATAGTGTGTTTTGTGCTGTAAAAGTTACTGTCCTGAACT
GCAGACCCCTCCCTCAGCTCCTGTGTTCCAAACTGTCTTTCAAAAGATTAACTGCACCAT
TGATCACTCTTGCACTAAGGGTTCTAGGTGAGTGAATGGAGAGTGTAATTGGACCTGTGT
AGGGTAGCAGGTGTTCTGGGCATGTTGCCAAATGAACCTCATGGGTAGAACCAGAGACCC
AGGAAGGCAGCCTCGGGCCATGGTCTTGGGTGAGCTTGGGTTCTGTGGTGCCAATCAGTG
TAATTAAACCCTTTGGCTGGTGAGAGTACCAAGTGTGGAATAGAAACAGTCCTGAATGAG
GAGTAACATTGGGCCAGTGCTGCAACTAGTTCTTGTTATATTGCAACAGCTCTGGGTTGA
CTTGCTAGTATACCCAGAAGTTTGCAGACACTGAGGATAAGGCCAGGATTAAGATTCAGA
GGGATCCACAGGCCACTGAGGGAGAACAGGCCATTCAGCTAGTTCTGCAGGGGCCTGGCA
GCCGGGAGTTTTATGTGAGCCACAGTTCCATTGTTCTAGGCTGCAGGGAGGCTCTGGTCT
GTGCTAGGTCATAGAGGTACCAACAAATGATACATGGCACCTACAGGGTGATACCAGGCA
TTTCACATTCCCACTGCTTGTTTGTTCCAGTGGCTGGCATGCACAGGCTATGTTCATGGG
TTTTGGACTGGTTGAGCCCAGCAAGGATGTCAGGACGCTACTGATCCCAGGGTTCTGCTC
CTCCATGGGAGGCACCAAAGCCACATGGGAAGGGTGTACCATGGTTTTGCCCAATGCCTA
TATCCCATCACTGGGATGTGTTTGGGACTGAGGTGGGCAGCAATAGTGAGAGGACTGTGT
CTTCTATGGGACCCACAAAAATACAGTTTGTTCAGGCAGTCTCCAGCTGAGCTACTGGCC
CTGTAAGACAACATTGTGTTGGTAGACCCAGGACCCAAAGTTCTAGGTCTTAGGATCCAG
AAGTTTTATGCTTATGCAGGCCTTTGATTGCTTGTCCAGTCCCATTTCCAGCCAGGACCT
GTGTGTTTCAGCTTGAAAGAATAATGATGGTAGCCAGTTCCAAGCTGAAGAATTACCTAG
TAGATCTCTGGATCACAGAGACCAAGCACACATACAGGGGTAGGAACCTGAAAACCTCAT
CTGGGATGATGGTGGCCTAAGCATGCTCTGGATCCGTGTATCCTATTATGCTGCTGCTGT
AGTTCACACCCAATCACCTCCCTATCCCACAGATAGTGTCACCAATGGAAGCCCCTACGA
GGTCCAGTTTGTGGAGCAAGGGCCGTGATCAAGGGCCATGAGCAATCAAGCTTGTTGTTC
CATCACCAAGAGAGAATGAAATGTTTCTGACTTCCTGAGGTACGTCAATCCTATGGGCTG
TAGTGTTAGGGCAGTGACAATGGGATTCCATTGTATGGTTCCTCTGGTTGGGTCAATGAT
GAGACCTCATACTGTCTTGAAGAGAGATGACGACTTAAAAATCATGCTCAATAGGATTAC
GCTGAGGCCCAGCCTAGTGACAGTGGTGCAGGAGGACAGCAGGGTCCCTATGTGCTTTCC
CATGCAAGAGACACTGTGGAACTTAGGCACCCAACTGGGAACACGTCCCAGGCAGCAGAT
CTGCTCCCGCGGGATCTACCCATCTATTGTCCTCCTTGGCAAGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCATCAGAACTCCCGTTGTATCCCACATGCCCAGATG
AGTGAACTGGGAGGAATCATGGGGCCTATGGGCAGTATCTGGGGGTCAGAGCACCTGTCA
CAAGCACAGGATGTGGACCTATGGTGAAAAAGGATGGACACCTCTGACTGTGCTCCAGAG
CCGGCTATACCCCTTTGGACTCTGAGATATAGAATGCCTTGCACGAACCCACGGCCTGGT
TCAGGGGCCAACTGAGAGTTGGCAATGGATCCCGGGGAAGGGTTTAGTGAGGCTGTTGGC
TTCCAATTCTCCTATGTGTACTAAAGTGGGTATGCATTGCCTTGATCTTTTATCTAGGAG
TTGGCAAAACTTGGGATTACATGTCTTTGTTAGGAACTGGCTCAGATTCTGTTGGAAGCA
TGGGAAGGGGATAAAAACCATCATGAGGGAGGGTTGATGGGAGAGCTGACTCTGCAGGTG
CCTGGTAGCATGGTAGCTTCACATGCCTGGTAACATGGTAGCTGAATACTAAGACACAGC
ACCATCAGGCAGTATCCAGTCTGGGGATTCGGACACTTAGCCTAGGTCACCTGAATGGTG
GTGCCAAGCTTGTCCCATGCCTGGCACTTGCCTCATCCAGGGATCAGCTTTCCTTCTCAC
ATGGGTGAGCTTTGAACCGAGGTGAACTTATAAGGACATGGGGTCTGTCTTGGTCCCGCC
ATCCACTTCTCCATGAGACGCACCAAAGCCCCACAAACGAAGGATCCATGTCTGGGCTGA
TGCCCCTTCCCCATGTTTAGGATATGTCCAGGACTGCTGAGTACAGACACCATGGGAGGA
AGGTATCTTGGAGTACATAGCTGGAGATCCTGGGAAGCAGGTTGTATTCACACCCACTAC
CTTAACACACAGGCCTGGCCTGGATAGAAATGCTGAGTGAGTCATGGAAAAACCCCACCA
AGGCTTCCTGTGATGCATCTTATGCCATCGGTTCTTTGATATCAGGTGCATGGAAGCCCC
TTCTAGTCAATACCGGGTCCTGGGCCAAATTTAGGATCGAGGTAAGAAGGGATTTGGTGT
TAGCCACTTCCAGCATGGTGACACAGTCTGACTTGCTCTCTCTGACCCTGTGACCAAGAA
GCCCAAAAGTTTCAGGCAATGAAGTTGTAGCCTGTGCAAACCAAGATGCCCACAGAGGCA
GCCTCCTGGAAACCTCACATGAGCTGATTAGAGTCAAAGCTCTCTCAGATTCAGTGCACC
ATAGCCTGTTCTTGCTGTCTGTTCACTCCCAGCTCACTCCATGTGCACAGATGAACAGAT
CCCGTTCAAGAGCTGTGGACAAGGTGCCAGCAACCAATGAGCAGCCAATGAACAATGCCA
GCCATGTTGAAGAAGGAATCGTCGAGGACTGCCTGAGGTAAGCCAATATTAATAGGCACT
ATCAGTGGGATTGCTTTCAGAGGTCTTGTTGTTTGTTTCTGTGGGTTGGGTCAATGATGA
GACCTCATACTGTCTTGAATGAGATGATGACATAAAAATCATGCTCAATAGGATTACGCT
GAGGCCCAGCCTAGTGACAGTGGTGCAAGAGGACCTTGGGTACCCAGGTGTCTTCAAGGT
GAGTATCACTAGGGACTGGAGACTTCAGGGACTCTGGATCATGGCCTCGACACAGTACCC
TACTGGAGCTGGCTGCTCATGCAGGGTGAACCCATGCTCCATCTTCCTTGGATTTCTTGT
GTTTTCCCCACTGTCTGAGTTGTCGGACCATACTTGGGGCTCCTTAGATACATTTCATCC
TCTTCTGTCTTTCAGTGTGAGGAGCTGCACAGTGGGGAACAGTTACACCCCAGTTTCCAG
GTGAGTGGATAGAGGGTGTCCATGGGCCTGTGTGGGCAGCAGGGGTTCTGTTGAGTCACC
AGACATGAGCCTCTGGGTTGGACCCATGGAGTCACAGAAAGGCAGACTTGGGCAGTACTC
TTGAGTGAGCTGAGCAACTTTGTGTTAATATCTGGAAGAACTTAACCTGCAGAGGCCCAT
GGTTGCATTGCTAGCATGGCTGTAAATGGGCCAGCACTAAGGACCAGGCAACTTTTTGAT
GGCAGGGCTCTGATCCCAATGAGGGCCATACAGATACCACATCAAGCAGTCAGTGAGTTT
CATGGAGCAACTGGCTCTGCAGGTGTCTGGTAGACAGGGAGCTTCATGTGTGTCACAAGG
CCACTGGAATCTAGGGCCCATGGACTCTCAACCTAGTATCTTTTCAGAAAGGTACATACC
CAGGCCATGGAAGCTGCTTGGTTGGCCTAGTCACAGATCATCCCCTGTGCTTGCTTTGAC
TAGGGGCTGGCATTCATGGCCACATTTGTGGGATTGGACTGTATTGAGCCCAACAAGAAT
GCCAGTGTAATACCTAGGCCTGGGCTCCCACTCCTTCATGGGAGGCAACAAGCACCATGG
TAAAAATGCACCATGGCCCAGCTCGATGTCACTACCCCGTTATCCAGACATGTTGATACT
GTGGTTTGTAGTATCAATTAGAAGTTGTTTCTACAGATACAACCTGATCTCTCAGAATCC
ACTATGCTTTTGCAGCTTGCACCCTTGCACATAGGCTTGTACAGCAACCCTGTGTTAGTA
AGAGAAAGGCCCTATGAATTACCCGTGGATATATTTTCCAGAGCATGTATTTTGATGCTT
TGATTGGGCAGTTGCTTGATTGACTAGCCTGGGTCCTACATGGATGTGAGTCTTGGGGGC
AAGAAGTATTTTTGGATTTAACCTCTGCTCTCAAGAAGATCCTGTCTGAGTCTTTCTTTC
TGTCCCAGTGACCAAGGCCCCACAGTTTTGGGTGACATGGGCAGAACTTGCCAGTGTCAA
CTCCAGCTACAAGATGGGCTCCTAGGAGGACTCACCTGGGCCAACGAAGCCAAAGCACAC
TGTGGAACCAGTGCACCCTTCCATGGCCCTGCAGCCTTTTCACCCCCATTTACCTCCTTT
TACCACAGAAGATGTCAGTAGAGGAAACCAAGGGGGCCCAGTGCCATGGGGACAAGGGTT
CTGGTGTATATCTAGTTGCACATTAGCTGGGGGTGTCATCCCCATAGGTGTAGGAAGTGT
CTGGGACTGCCTATGGTACACCAAAACATCCAGGCCATGGAGTTAGTATGGATATAAGGG
GTACTCTTGTGATTCCTGGTTTTGGGTTGATGATGAGACCTCATACTGTATCGACGTGAC
TTGATGACTAAAATTCATGCTCAATAGGATTGCGTTGAGGCCCATCCAAGTGAAAGTCAG
TCAAGAGTATTCCAGGGTGCACATGTGCCTCAAGGGTGGAGAACCTGAGTATTGGATACC
AGGAGGCCCCCCCAGGCCAAGTGTAGTCTCCAGTATTGAGTTTTGAGTGCTCCTGCTGGA
ACCATCTAAGCTCCATCCTCCTTGAACTTGGTGTGTGCTCTCTACTGGCCGCTTTGCAGG
GTAATGCAGAGTCTCTTCAGCTCCCTGTGCTCCCTTGTTCTTTCAGTTAGATATGCTACA
TGGCAGGTATCATAGTGTCCAAGGCACTTGCTGGTATGACTAAGTGAGTTGACAGTAGGA
TCAGGCCTCTGTGTTTGGGCAGGCCTCAGTTCCTCTATAAGGCTCATATGGATGACCACC
CTAAGTGTAGTAATTTTTTGGAGCAGCTGGATCTGCAGATATCTGGAATCCTGGTAGCTT
CATGTAGGTCACAAGGCTACTGGAGTCTAGGACCCAGGGACTCTCAGTTTGATATCATGT
CATTGGATGTCAATAATTGGCCCATGGCATCTGTAGGGTGACTTCAAGGACACCCCTTTT
CTATCCCTTGACTCTTTTTTTTGACAGGCAGAGTGGACAGTGAAAGAGAGAGAGACAGAG
AGACAGAGAGAAAGGTCTTCCTTTGCTGTTGGTTCACCCTCCAATGGCCGCCGCGGCTGG
TGCACTGTAGTCGGTGCACCGCGCTGATCCGATGGCAGGAGCCAGGTACTTATCCTGGTC
TACCATGGGGTGCAGGGACCAAACACTTGGGCCATCCTCCACTGCACTCCTGGGCCATAG
CAGAGAGCTGGCCTGGAAGAGGGGCAACCGGGACAGAATCCGGTGTCCCGACCGGGACTA
GAACCCGGTGTGCCGGCGCTGCAAGGCAGAGGATTAGCCTATTGAGCTGCGGCACCAGCC
CCATCCCTTGACTCTTAATAGTGCTGGTGTTCATGGATCATGAAGAATGACTCAGAATAA
TGGGCCTATTAAGGATGCCAAAGCATGTCCTGTGCCCATGTTCCCACTCCTCCATTGGAG
ACACCAAGGCCCCTTGATAGAGTTATCCATGTTCCATCCTAATGGCCATAACCCATCTTT
GGGGTGTATATTGCATTTAGATGGGCTGTGACCATCAGCCAACAATGATTCTGGTTGGCA
CAGCCTTAGCTCCTAGAATCCACTGTTTGCCTGCATCCTACAACCATTTGCCCAGGCCTA
TACAGTGACCCTGTGTTGGTAGGCACAGGGCACCATGGGTGTTTCCTTGGGTTATATTGT
GAAACCAGTCTTCCGATTCTTGGGCCGAGCCCTCACATGCTTATCCATCAAGGTTTCCAT
ATAGGCCTTTCAGGGTAGACCCATAGGAATGCACACCTGGATGCTACCCCCAGTCATGAA
TGCAGTCCCTAGGAAAAATTCTTTATCCTGCTGGATCCATCCAAGCTACTTTTTCCTTAG
GCATGGTGTATGATCCCAATTTGCCAAGTTGTGGGTATATCTTTGGGCACTGCTTCTTCA
TCTCCCTTCATCCTCTTGTTTCTTCCAGTGCGATGTGCTACCAAGTGGTAGCATCCACAT
TTGCATCCTGGTTCCCAGGTGAATGGATGGCATTGGTCCTGTGTGTTGCAGTTGGGTATC
ATGGCTGATCACTCAATGCAAAATTAGGGATGTACCCTGGGAGGCACCAGAAGACAACCT
GGGGCTATGCTTCTCAATGAGCTGTCCCTCTGGGCTCTGGGTTTCTGAACACTTTTCCTG
AATCCTTGGAATGGTGTGGGCACCTGGAAAGGAATGAAAAAAATTCCTGAGGGAGGACCC
TACACTTCCAAAGCCACTGTACCTATGGAGGCTGTAACATCTCTATGTTGCCTCTTGGTA
TAACCAACAGTATTAAGACACTAGGGATCTCAGGCCGGCGCCGTGGCTCACTAGGCTAAT
CCTCCGCCTTGCAGCGCTGGCACAACGGGTTCTAGTCCCGGGCGGGGCGCCGGATGCTGT
CCCGGTTGCCCCTCTTCCAGGCCAGCTCTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATG
GCCCAAGTACTTGGGACCTGCAACCCCATGAGAGACCAGGAGAAGTACCTGGCTCCTGCC
ATCGGATCAGCGCGGTGCGCCGGCCGCAGTGCGCCAGCCGCGGCGGCCATTGGAGGGTGA
ACCAACAGCAAAGGAAGACCTTTCTCACTGTCTCTCTCTCTCACTGTCCACTCTGCCTGT
CAAAAAAAAAAAAAGACACTAGGGATCTTGTGTATGGAAGGTGCAGGTTTCATCTTCTTT
AAGAGGTCTGGTTCGAAGACCAATTTGATGATAGGAAGAACGTTTGACCTGATGGTGCCT
CTGCAGGTTTCTAGCAGCCTGAGATCTACAACTGGGTTGCAGTGCCCCTGGAACCTAAGA
TGCATGGACTATCAGTTTGATGCCCAGTGAGGGAGCAGCAGGCATCTGTGTTATGGTTCC
TACAGGGCCATAGTACAGTTCAGTGCCCTTACTCCAATGTGGGATGTGCATGTGACTCAG
TAGGCAACATCCTTGGGGGAAATTTTCTTTGGGGTCCATAGCCTGAATTCGTGGGTTCCA
GTGTGAACTTAGATCATGCACCTGAGCCTCCAGGCCTGGACAAGGATACAGTGTTGGTAG
GACCAGAGCTACTTCTGAGATTCCTTTGGTGAGACACTTGCCACTATTCCTCTGAGATGT
ACCAGTGCTAGAATGTTCACCCAGAATACAGGCGCAAAGATAGTCCTCTGGGGGAGCTAA
GGGGCACTGGGACTCCCAGGTGAGTGCATGGCAGGGACCATGGCTTCTTTGCTAGGGATC
TGATTGTCACGACGGGTTATCTGTGGTCAAAGGCAAGCTGTGCCCATTTGGGCTCTGAGG
TCTAGAATATATTGCATGAACTCCTGGCCTGGTTTGGGGGGCAATTATGTTATGCCAAAG
TTCCTATGGGGATGGTCAATATTTGGCCTGTGCCCTGTCTTTTTCTACATGAGCTGCTGT
GGCTCTGGGTTGTCTTGCCTGTTTGAAGTTGTTGAACTCTAGGGCTCTGGCCTCTGTGTT
TGTACAATTTTTAGGTTTCCTAGGATGACTCGGATGAGGACACACCAGGATAGGGACCAA
GGTATGGGGCGGGGGGGTACCAGGCTCTTTGTTGCTTGGCTGCCTGGGAGCTTCATAGGG
GTCATGAGGTCTCTGGTGTCATGATCCAGGGTCTCTCTGGCCAATGCCCAGTTATGGGGG
TACCAAAACCTAGGCAAGGATATGCACTGGTTGGTGCCGATCATACCCTGTCCCCTCACT
TGATTGTCTAAAATCTAGCCTTTGCTGGCCACTTAGGTGGATTTTGGACTGAGCTGATTT
CAGCAAGGCTGTCAGGGCCCCTCCTAGGGCCCATGATCCTGCTCCTCCAGGGGAGGCCAA
ATGGCTCCATGGCATGGGTATATCATGGTCCAGTCCGATGATGGTACCCTATGTTTGTGA
TGTATGCAGGACTATGGTCTCCCATGACCGTAGGAGGAATGTGTATCAGTTGCTCACTCT
CTGAACTCAAGAATCCATGTGTGCATGCAACTGGCACCTGAGGTCTCAGGCCTGAATGGG
AATCCCTTGGTGTTAGGACCAGGGCACCACTAGGGGCTCTTTGGGTGTTTTATTTGCCCA
GTACTCTGAGCCCAATTCTTTGCTACTGCTTGATTGTCCATCCTGGTTCCTCCTGCATCC
TGGGTAAGGGGTCAGGAAGGAGCTTTAGCGGAAGCCATCTCTGGGAAGGCAGCCTGGCCA
GAGTGTCCTCTCTGTGCCAGTGACCAAAAGGTCCAGCATTTCTCAGGCAAGATGGTGGAG
CTTTTCCGACCCCATCACACCTACAGGGTAAACCTCATAGGAAGCCTCAGTTGGGCCTTG
GGCCAATATATTCTCTGGAGCGAGTTTATCTAGCCTGCACCTGCTGTGTATTCACACATG
CCTCTCCCAGTCCCATAGATGATGTCACCAGAAGAAGCACGCAAGTGTTCCAGTACCCAG
GGACAAGGGCTGTGGTCATTGACCCAACAGCCCACAGACTCATTTCTGCCAGCATCATTG
GTAAAGGAAATGTCCACAACTGCCTGTGGTATTGAGTCCATCCAAGCCTTGGAGTTGGGA
TGCTGCCAATGCTCCCTGTGCTGTGGTTTGTGGGGTTCGGTCGATGATGAGACCTCATAC
TGTCTTGAAGAGAGATGATGACTTAAACATCATGCTCAATAGGATTACGCTGAGGCCCAG
CTTAGTGATGGTAGTGCAAGAGGAACTTGGGGTAATGAGGTGCCTTCCAGGAGAGGAGAC
CCTGGGAACTGGAGAACTCAAGGCCCACATTGTCAGGACATGATTTTCTGCAGGATCATC
TGCTTGTGCAGTATTCACAAAAACTCAATCCTCATCGGATTTGTTGTGTGCTCCTTGCTG
TAAAATTCACTGTCCTACATTGGAGGTTCCTCCCTCAGCTCCTATATTCCAAGCTGTCTT
TCAGTTTAATGAGCTGCCCAGCGGAGCACTCTTGAACCAAGACTTCTAGGTGAGTGGCTG
GAGGTTGTAATTGGGCCTGTGTAGGGAAACAGGTTTTCTTGGTTTGTCACCTGATAAGCT
TAATGAATGGAACCACAGAGACCCAGGAAGGCAGCCTCAGGCCAGGCTCTTGGCTAAGCT
ATGACTCTTTGGGTTCTGAAGAGCAGATCAACGTACTTAAATCTCTTGCCTTGTGACGTT
TTTAAGCAAGGAATAGAAATAGTCATGAACTAGGGGACACATTGAGCCAGTGCTGCCACT
GGTTCTTTTACTGCTATAGATCTGGGTTGCCTTGCTGGTGTGGGAGGAAGTTGGTGTACA
CTGAGGATCAGGCCACTGAGCAGGGGCAGGGATAAGATTCACAGGGAGTCCCAGACCAAA
GACAACACCAAGGCAGTGAGGGAAAGTTGGTCTTTCAGCCAGCTCTACAGATTCCTGGCA
ACCTGGGAGTTTTATTTGGGCCAGGGTTCCACTGTACTATGCTGCAGAGATGCTCTGGTC
TGTGCCTGGTCAGAGAGGTACCAACAAGTGATCCATGGCACCTACAGGTGGTGCCATATG
TACTATATTCCCAGGGCTTGCCTGGTCCAGCAGCTGTCATTTGCAGTCCACGTTTATGGG
TTTTGAACTAAGTTGAGTCCACCAAGGATGCCACAGCCCCTACTGAGCCTGGGGTTCTGC
TCTTCCATGAGAGGCACCAAGGCCACAAGGGAGGTATGGGTAATGGTCTGCCCATTGTCT
GTATCCCGTCAATGGGATGTGGTCAGGACTTAGTTGGGCAGCAACCATAGGAAGACAGTG
TCTCCATGGGACCCAGGCTGTCCTCTGAGGATACAGTGCATTCAGGCAGCCTGTTCCTGA
GTACCTGGGCCTATAAGGTGACACTGTGTGTGTGTTGGTTGGCTCAGGACCCACAGTTAT
ATGTCTTGGGGGACCAGAACTTTGATGCTTATACAGGCCATTGCTTGCTTGTCCATTCCA
GTTACCTGCCGGGATCTGGGTCTTATGGGCTTGAAGGAGCGATGGTGTTAGCCACTTTCA
GTAGGATTATTCTGCCCTGGAAGGCCTATCAGTCACCAAGACCAAACACACTTATAGGGG
TGGGCTCCTGGAAGCCTCACCCGGGCCGAAGGGGGCCTATGCATGCTCTGGATCCAGAAT
ATCCTATTTGCCCCTGCTGTCTCTTCACACCCATTCATCTTCCTGTCCCACAGATGACGT
CACCAAGGAGTCCCTGTGGGTTCAAATCCCCATGTGGAAAATCATATGGGCCATACACCA
TAGTGTTAGGGAGGCAAAAATGGGATTCCATGTTGTGGTTCTTAGGGTTGGATCAATGGT
GAGACCTCATACTGTCTCAAAGAGAGATGATGACTTAAATATCATGCTCAATAGGATTAC
ACTGAGGCAAACCTAGCATCAGTATAGCAAGAGGACACCAGTGTCTCCACATGCTTTCCA
GTACAAGAGACACTGGGGACTGTAGACCTGAAGCTACCCTGGCCAGAAAACAGTCCCAGG
CAGCAGCTCCTGCTCTTGAGGGTCCAGATAAGTTTCTTCCACATTGGGGAGGGGTGTGTA
TTACATGGACCAGGTTCTGGTTCCGTGCTGGGGCTCCTTCTTCAGCTCCTTTCATCACCT
TATGCCTTTGAGTGAGATGTGCTGCCCGGCTTATGACCATTGCATCCCACATCTCAGTGA
GTGGATGGTGAGGATTATAGGGACTCTAGGCAGTATTTGGGCATCTGAGTGCCCGTCATG
AGCACAAGAGGTGGACCCATGGCAAAAAAGATGGCTGCTTTGGGCTGTGCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAATAGCTCTGCATTGCCTTGATTTTTTGGCTTGGGAGTGGCATTTTA
CTTAGGATTAGGTGTCTTTGTTGGGGAGTAGAACAGATTCTGTTGGAAGCCTGGGCCAAT
GACCACAATCACAAGTGAGAGAGGTTTAATGGAAGAGCTGACTCTGCAGGTGTCTGGCAG
CATCATAGCTTCACATGCCTGGAAGCATGGTAGCTGCATACTAGGACAAAGCACATCAGG
CCCTGTCTAGTCAGGGGAATTTGGAACCTAGTCCAGGGCACCTGTGCAGTGGTGCCCAGC
CTGCCCCATCCCTGGCACTTGGCTCATCCAGTGGCCAGCATTCTCTGCCACATGGGTTAT
ATTTAAAATGAATTGAACCTATTAAGGACACAGCGTCCCTCCTCATCCCTGGCTCCTACT
GCTCCATGAGATGCTCCAAAGACCCACAAACAAAGGATCTGTGGTCCAGGCCTATGACCC
TTCACCAACTTAAGGATTTCTACAGGACTGTGGTGGGCATAGAGCATGGGAGGAAGTGCA
TAGCTGGAGATCTTGAGAAGCAAGTTGTGTCCATGGACTCTCCCTTAACACACAGGCCTG
GCCTAGGCAGGAATGCCTTGTGGGTTATCACAAGGCCCCATAAGGGCCTTCTGTGATGCA
CCTCATGCCATTGATTCTCTGATATCAAGTTCATGGCAGCACTTTCTAGTCCAGCCCAGG
TCCCAGGCCAGATTTGGGCACAAGAAAAGAAGCAGAGTGGGATTAGAATCTTCTAGCATG
GTAACACCGTATGAATTGCCCTCTCTGGCCCTGTGACCAAGAAGCCCAAAAGCTTCAGGC
TAAGTGATTAGAGCCTTTCCAAACCAAGATGCCTACCGGGGCAGCCTCTTGGAAGCCTCA
CCTGGACCTACAGAGTCAAAGCACGCTTGGGGGTCAGTGTTTCCTGGCCTGTTACTGCTG
TCTGTTCACTCCCAACCATCTCTGTGTGTCCATAGATAATGTCAGCTGAGGAACCCCTGT
GGAGAACCGACCCCATTGCAAGAGATATGGTCAAGGTCCTAGGAATCAATGAGCTGTTGA
AGAAGGAATGTCCAGGACTGCCTGAGGTAAGAAAATCTTAGCAAGCCCTGTCATTGGGAT
GGCTCCTAGGGGTTCTTGTGATGTGTTTCCAGGGGTTGGGTCGATGATGAGACCTCATAC
TGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCAG
CTTGTGACAGTGGTGCAAGAGGACCTTGAGTAACCAGGCGCCTTCCAGGGGAGGAGACCC
TGGGGACTGGAGACCTCAAAGGCCTCACAGGCCAGAACACAGTGTCCACACTGGGGTGGC
TGCTCATGCAGGATGCACCTATCTTCATTTTCTTTGGTTTATTGTGTGCTCCCCATTGTC
TGAGTTGCAGGGCATTGCTTGAGGCTCCTTCTTAGATCCTTTCATCTCCTTCTATCTCTC
AGTGAGAAGCTGCACAGCAGGGGCACTTTTGCACTTCAGTTTCCAGGGTGAGTGGATAGA
TGGTGTCAATGGGCCTGGGTCAGCAGGGGTTCTGATGTGTCACCCTACATGAGCCTCAGG
TTTGGACCCATGAAGACACAGGAAAGCAGACTTGGACAGTCCTCTTGAGTGAGCTGTGCC
TTTGGGTTGATGTCATGAATACCTTACCAGCAATGGCCCATGGTTGCATTGCTAGTGTGG
CTGTAGGTGGGCAGACACAAGGGATCAGGACTATGTGTAATGGCAGGGCTCTGATCCCAA
ATGAGGCCCATACAGATGACACACCAAGCAGTCAGTGAGTTTCATGGAACAGCTGGCTTT
ATGGGTATCTGGAAACCAGGAATCTTTACCCGTCTCACAAGATCTCTGCAGCCTAGGGCC
CGTGGACTCTCAACCTGGTGTCTTATCAGGGAGGTACCAATGCCGGAGCCATGGCACCTT
CAGGGTGGTGCTAGCCACACCCCATCCCTGGTGATTGCCTCACCTAGAGGCTGGCATTCT
CTAAGCCACATTGATGGGCTCAGATGATATTGGGCCCTCTCTTGACCTGCCTGTGCAACT
CCTGGGCCTAGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACT
CCTGCTTGAGAATTATCAAGGCTCCATGGTAGAAATCGTTCCAAGGCCCAGCCCAATGTG
TCCATCCCTTATTCAGATATGTTGATAATGTGGTTGGTAGTAATAATAGGAGAAATTTGT
TTCTGAAGGCCTCATCCTGATCTCTCAGAATCCACTGTGCACTCTCAGCCTGCACCCAAG
CTCCCAGGCCCGTACTACAACTCTGTGTTAGTAAGCCGAAGGCCCTACAAATTACCCTAG
TGTATGTCTTCTGGGGATGGCATTCCAGTGCCTAGACTTGGAAATTTTCTGCTTGATCAG
CTTGGGTCTTGCATGTACATGGGTATTGGGTATAGGAAGTATTGGTGGATTTAGCCACTG
CTGGCAAGAAGATCCTGCCTGGGTGTTCCTCTCTGTCCCAGTGGACAAAGGCCTTACAGT
TTTGAGTGAAGTATGCAGAGTATGCAGAACTTGCCAGTCTCTACCACAGCTACATGATGG
GCTCCTAGGAGGACTCATATGTCCACGATACCAAAGCACACTCTGGAACCATTTAAATGT
GGCTGGCCCTGCTGACTGTTCACAACCATTCACTTCCTTGTCTCACAGAAGATGTCAGCA
GAGGTAACCAAAGGGTCCCAGGAGCCACAAGGGTAAAAGCTATGGTCTAGGTCTAGTGGC
CCATAAGCTGACAGTGTCAGTCCCATAGGTGTAGGAAATGTCTGGGACTTCCCATGGTAT
GCCAATCCATCCTGACCATGGAGTTGGCTTTAGGGGCTTCTCTTGCTGTTTTTCCTGGGG
TTGGATTGATGATGAGAACTCATACTGTCTCAATGTGACATGATGACTTAAAAATTCACA
CTCAGTAGGATTACACTGAGGCTCTGCCAAGTCACAATCAGTTGATTATCCCAGGTTCTA
CACATGCCTTTCACGGAAGAAGAACCTATGTATTGGACACCTGCATGCCCCCCAGGCCAG
TCTGTAATCCCCAGGCTTGAGCTGCTACTTGTGCAGAAACCACAAAAACTCCTCCTTGAA
CTTGGTGTGTGCTCTCTACTGGCCATAATGCAGGGCCATGCTCAGGCTCCTTCTTCAGCT
CCCTGTGCTCCCTTGATCTTCCAGTCAGATATGCTGCTGGGAAGGATACCCTAACATCCC
AGATTCTTGCTGGTATGGCCGTAGGTGGGCAGACACTAGAGATTAGGCTTCTGTGTGGAA
GCAGGACTCAGTTCCTTTATATGGCACAGGTGAATAACCACACCAAGTGAGGGAGCTTGG
TGGAGCAGCTGGATCTGCAAGTATCTGGAAGCCTGGTAGCTTTATGTTGGTCACAAGGCC
TCTGGATTCTAGGTCTCAGAGGCTCTCAGTTTGGAGCCTCGTTTGGGAGTGTCAATACCT
GGGCCATGGCTCCTGTAGGGTGGTTCAAGGGACACCCTATTCCCTCCTTTGTCTCCTTTA
GATGCTGGGGTTTGTGGGCCATGAGGAATGACTAGAACTGAATTGGGCCCATCAGAGATG
CCAGTGTACCTCCTAGATCCATTCTCCCAGTCCTCCACTGGAGGCAGCAAGGCCCAATAG
TAGAGTTGTACATGGTCCATCCTAATGCCCCTACCCCATCTTTGTGTGTGAATGGAGATA
AGCTGAAATTGTCTCTGGGTGGCTTACCTGAGCTCCCAGGATCTTCTGTGCTCACGCATC
CTGAAACTGGTTGACCTGGCATGGACATGGCATGACCCCATGTTGGTTGACCTAAGGCAC
CATGGCTGTATCCTTGGGTTTGTCTTGTGGGACCAGTCTTCTGGTGCTTAGGCTGGGCCA
TTGCTTGCTTCTCCAGCATACTTTCTGGATAGGACTTGGATCTGGGGGCAGGAAGGAATG
ATGGAAGTAGCCTCTGCTGGCAGGATGATCCTGTCTGAATGTCTTTCTCTGTTCTAGTCA
CCAAGAGTCTCAGAGGTTTTCTAGACACAGAATGCCTAAAGCGATGGACTCCTTAGAGGA
CTCCCCTGGGCCTACGAGGCCAAATCATGCTCTGGAACCTGTGCGTTATGATCTGGGCCT
GCTATCTGTTCACACCCAGTAAGCCAATCTATCCATCCAGACCCTTAAGTTAGGATGGCT
CCAGGGACAGCTCCTGCTATGTTTAGTGGGGTTGGGTCGATGATGAGACCTCATACTGTC
TTGAAGAGAGATGATGACTTAAAAATAATGCTCAATAGGATTACGCTGAGGCCCAGCCTA
GGGACAATGTGTCAAGAGGCCCTGGGGTCCACAAGTGCCTTTCAGGGGAGACCCATAGGG
ATGCACAGCTGAAGGCCCCCCCCTAGTCCTGACTGAACTCCCCAGGAAAGAGTGGTTGCT
CCTACTATATCTAGCCATGTTCCTCCTTGGGCATAGTGTATAAACTCAACTGGCCAAGTT
GTGGGGACGATTTAGGTGGCTCCTTCATCATCTCTTTTCCCTCTTGTTTCTTCCAATGAG
ATGTGCTACCCCGCAGGTCACACTTGCATCATGATTCCCAGGTGCGTTGCGTGGCATAGC
TATAGGGCCCACTGTGGTAAAGTCGGATAACATGGCTGAACACCCAGTGAAAGCCTTTGG
AGTGTACCATGGGAGACACAACAGGCAGCCTGGGGACATGCTTCTGAGTGAGCTATACCA
CTTTTGGCTCTGATGTCCAGAACAACATACCTGATTCCCCAGCCTGATGTGGGTGCCTGA
CAAGGAATGGAAACTCTTCTTGATGGAGGGTTAATGTACTTTCAAATCCACCACTGTACC
TGTGAAGGCTACAGCATCTCTATGTTGCCTTTTCATGTGACCAGCAGTATTGAAACACTA
GGGATCAGGCGTCTCTGAAGGTGCAGGTTTAGATACCTTAAGAGGTCTGGGCCGAGGACC
ACATTGAGGATAGGTGGGAAATGGAGATGGAGGTATTCCAGCTCTGTGGGTCTCTAGCAG
CCTGGGATCTTCAACTGGGTTGCGTGGCCCCTGGAACATAGGACACAGGGGTGATTAGTT
TGATACCCAGTGAGGGGGTTACAGGTATCTGTGACATGGCACCTGTAGGGCCATGATCCA
ATCCAGTATCCTTACCCCAATGTAGGATGTGCATGGGACACAGTAGGCAGCATCCATTGG
AGGAAGTTTTCTTTGGGGTCCATATCCTGAACTCACAGATTCCATTGTGTTCTCAGAGCC
TATACCTAAGCCACCAGATCTTGACAGATATATACAAGATACATATATCTTGACAGATAT
ATGTATATACATATACAGATATGTATTTGTAGGACCAGAGCTCCCCCTGTAACTCCTTGG
TTGAGGCTCTTGCCACCACTCCTCTGAGCTTCTCCAGCACTAGAATGTTCAGCCAGGGTA
AAGTCCCAAATGTAAGGCCTCTTGGGAGGAGAGGAGCAGTGGACTCCCTGTGAGTGCATG
GCAGGGACCAAGGATCTTTTGTAGGGATGTTAGTGTCTAGGCGGATCACCCAATGCAAGC
CTAAAGGATGGACCAACAAAGACACAGTAGGGTTGCCACAGGCTGTGTTCCAGAGCAAGC
TGTGCCCATTTGGGCACTGAGGTCCAGAATTCATTGAATGAACTCCTGGCTTAGTTTTGG
TGCCAATTAAGGTTCCAGGGGATGATTCCCATTAGTCCAGTGCCCCTACTTGTCCTAGGT
TAGCTGCAGTGGCTATGTGTTGGCTTGCCTGTTTGGTCAGAAGTTTTGAAGTTTAGGGGT
CAGGCCTCTGTGTGGCATTAGGGTCTAAATTCCCTAGGAGGCCTTAGATGAGGACATACC
AAGGTAGGAGAATTTTGGTGTGGTACCAGGCTCTGTAGGTGCCTGGCTGCCTGGGGGCTT
TATATGGGTTATGAGGACTGTGAAGCCATGATCCAGGAACTCTCTGTCCAGTGCCCTGTT
ATGGGGGTGCCAAAAGCTAGGCCAGGACACCCACAGGTTGGTGCCAATCATATCCAATAT
CTCAGCTCTGGCCTTCCAGGCCAGATTGGTGGACTTCAGACTGAGCTGATCTCAGCAAGG
ATGTTAGGTCCCCTCCTAGGTTCCCTGGTCCTACTCCTCCAGGGTATATCAAAAGGCTTC
ATGGTATGGCTGTGCCATGGTCCAGCTGGAGGCCAGTATGCAATCATTGCAATGTGTAGA
GGACTGCAGTGGGCTGTGACCATGGGAGGAATCTGTCTCTGGTGCACACTTTCTGAATTC
TGAGAATCCATTGCATGCAACCAGAACCTGAGCTCCCAGACCTGAATGGGGATGTCTTAT
TGTTAGGACCAGAGCACCACTAGGGCCTCCCTGGGTTTGTCTCATGTGACCAGTCCTCTG
AGACCAATTCTTTGCCACTGCTTGAGTGTATAACCCAGGTCCTGCTGAATCCTGGGTACT
GGGGTCAGAAAGGAGCTTTAAGGGAATCCATCTCCAGGAGGACAACTTTGCCTGGGTAGC
CCTCTATGGATCAGTGACCAATGGACCTAGCAGTTCTCAAGCAAGAGGGTGGGGCTTTTC
TGATCCCACTGCATCTATAGGGTTGGCTTAATGGTAAGCCGCACCTGGGCCAGCAGGGCC
AATGCATGCTCTGGAGCCAGTGTATCTAGCCTGCACCTGCTGTGTGTTCACAACTACCTC
CTCCCAGACCCACAGATATCACAGGAGCAAGCATGCATGTGTTCCAGTGCCTAAGAGGCA
AGGGCTGTTGTCATGGCACAATCAGTCTAAGAGCTCATTCTGCTAGCACCATTGAAAAAG
GAAATGTTCGCAACTGCCTGTGGCAAGCCAGAAATCTGAGCCTTGGAGGTGGCGTAGTGC
CAGGTGCTTCCTGTGCTATGGTTCCTGGGGTTGGGTCTATGATAAGACTTCATACTGTCT
TGAAGAGAAATGATGACTTAAAAATCATGCTCAATAGGATTACCCTGAGGCCCAACCTAA
ACATTAATGCAAGAGGAATTTGGGGAATCAGGTGCCTTCTGGGGGAGGAGACCCTGGGGA
TTGGAGAAATCAAGGACCTCCTCCTTGGAAGGACATGATCTATAGGCAGGATCCACTGCT
TGTGCAGGATTCACACAAACTCTGTCCTCATTGGGTCTGTAGTGTGTTTTCTGCTTTAAA
ATTTGCTGTCCTGTGGGGGGGGGGCTCCTTTCTCAGCTCCTGTGTCCGAAACTGTCTTTT
GGAAGGTGAATTGCACCATCAATCACTCTTGCACTAAGGGTTTTAAGTGAGAGGATGGAG
GGTGTAATTGGACCTGTGTGGGGCAGCTGGTGTTCTGGATATGTTGCCTGATGAACTTGA
TGCGTGGGACCAGAGACCCAGGAAGGCAGCACTGGGCCATGATCTTGGGTGAGTTATAAC
CCTTTGGGTTCTGAGGTTTAGATCAATGTACCTAAACCCCTTACCTTGTGAGGAAGGGAA
ATGGTCCTGAATGAGGAGTCACGTTGATCCAGTGCTGCAAATCGTTATTGTTATACTCTA
ACAGCTCTGGGTTGCCTTGATGGTATTCCCAGAAGTTCATGGACACTGAGGATAAGGCCA
GGGTTAAGATTCACAGGGAGACTCAGGCCAGTGATCACACCAAGGCACTGAGGGAGAACT
GGCTATTCAGCCAGCTCTGCAGGTACCTGGGAGCCTGGGAGTTTTATGTGGGCCACGATT
CCGTTGTACTAGGCTTTAGGGAGGCTCTTGTCTGTGCCCTGTTACAGAGGTACCAACAAG
TGATCCATGACACCTACAGGGTGGTACCAGGCATTTCACATCCCTACTGCTTCTTTTTTC
CAGCGGCTGGCATGCACAGGCTATGTTCATGGCTCTTAAACTGTGTGCCCAGCAAGGATG
TCAGGATGCTACTGATCCCAGGGTTCTGCTCCTCCATGGGAGGCTCAAAGCCACATGGGA
AGATTATGCCATGGTCCCTGCCCGATAACCGTATCTCATCGCTGGGACATGTTTGGGATT
GAGGTGGGCAGCAACCATAGGAGGATGGTTTTTTCATGGAACTCAGCCTGTCCTCCAAGG
ATACAGTGTGTTCAGGCAGCCTCCACCTGAGCAACTGGCCCTGAAAGCAACACTGTTTTG
GTAGGCCCAGGACCCACAATTGTAGGTTTCGGGGCCCAGAACTTTAATCCTTATACAGGC
CATTTCTTGCTTGTCCAGTATAATTTCCTGCCAGGGTCTCGGTCTCATGTGCTTGAAGGA
GAAATGGTGGTAGCTACTTCCTGTGGCAGAATCCTGAAAGAATCATGCTAGTAGGCCTCT
TGGTCTCAGAGACCAAGCACATATACAAGGGCAGGCTCTTTGAAGCCTTACCTGGGCAAT
GGGGGAGTAAGCATGCTCTGGATCCAGTGTATTGTATTCTTCCCCTGCTGTCTGTTCACA
CCCATTCACCTTCCTATCCCGCAGTTAATGTCACCAATGGAAGTCCCTATGAGGTATGAG
GTCCAGTGCCATGGGGACAAGGGCTGTGGTCAAGGGCCCATGAGACCTGAAGCTTGTTGT
TCCATCCCTGCAGTTGAATGAAACGTCACTGACTTCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAG
GTAAGTCAGTCCTATGGGCTATAGTGTTACAGTAGTGACAATGGGATTCCATGGTATGGT
TCCTAGGGTTGGGTCAATGATGAGACCTCATACTGTCTTGAAGAGAGATGATGACTTAAA
AATCATGCTCAATAGGATTACGCTGAGGCCCATCCTAGTGACAGTGGTGCAAGAGGATCT
TGGGGTAATCATGTGCCCTCCAGCAGAGGAGACTCTGGGGACTGGAGATCTCAAGGCCTC
ACAGGCTAGGACACAGTGCCCAGACTGGAGCAGCTGCTCATGCAGGGTACACCCATGCTC
CATCTTCCTTGGGTTTGTTGTGTGCTACCCACTGTTTGAGTTGCAAGACCATGCTTGGGG
CTCATTTTTCAGATCCTTTCATCCCCTTCTCTCTTTCACTGAAAGGAGCTGCACTCAGGA
TACCCTTACACCAGTTTTAGTGTACCTTTACACCCAGTTGAGTGAATAGAGGGCGTCCAC
GTACCTGTGTGGGGCAGCAGTGGTTCTGTTGGGTCACCCGACGTGAACCTCAGGGGTGGA
TCCACAGAGTTAAAAGAAGGTATCCTTGGGAAGTCCTCTTGAGTGAGCTACGCCACTTTG
GGAAATGTCCTGAACATTACCTGAACCTTACAGGAACTTCTGCCTTGTTCAGAGATTCAT
ACAAGAAATGGAAACATTTCTGAGTGAGGATTAACCTGGGTCCAGTTATGCCACAAGACC
TGGCTGGGCATCAACAGCTCTAGGTTGACTTGCTGTTGAGGCCGAATGTGGGCTAACCCT
GGCAAACAAGACTCTGTGTGGGGATAGGTTTTAGATTTGGTGGATCCAGGTCCAAGCTAT
GTCAAGGCAGGGTGAGATGACTGGAGTGGCAATGACTATGCAGGAGCCTAGGATCTTCTA
GTGGTGGGCAGGGCCACTAGAGCCTAGGACAGAGGACTATAGGGCTAGTAACCATTCAGA
GGGTGCCAATAAAAATGACATGTCTCCTACAGCATGGTGCCAGGCATGCATATCCCTGCC
ATTCACCCTGTTCAGGGACTGGCATCATCAGGCCATGTGGATGGAATCAGGCTGAGGTGA
GCCCAGAAAGCATGGCAGGGCTCCTTCTGGCACTGGGCTCCCACTGCTCCACGGGATGCA
CCAAGGTCCCACAGTAGGGGTAGGTTGTGGTCCAGCCTAATGCCCATACCCTTTCTTTGA
GATGTATAATGTACTGAGTTGTATAGAAACCATAGGAGGAAGCTGTATCCGAGAAACACA
GTGTATACTCCAGGGATATGTCGTGTACATATAGCATAGACCTGATTGCCAGGGCCTGGA
TTGTGATGACTTTTTGTTAGTCCCAGGGACCTATGGGGGACACCTTGATTGTATGTTGTT
CAGCTAGTCCTCTTGCCAATTCAGTGCCAGTGCTTGGTTTTCTAGCCCAGCTCCCTGCTG
GATCCCAGGGACTAGGGTCAGGAGAGAGCAGTGGAGGATGCTGACCTAGTGACCAATGGG
CCCAGCACTATTCAGGTGAGGTGAGCAGAGCTAGCCCAATACCACCACACCTATAGTGGC
AGCATGCTAAAGGACTCAGAAGGGCCATTGGTGCCAGAGGACACTCAGGAACCAATGTAC
TCAGAGCATGCTCCTGAGGTCTATTCATACCTGCCCCCTTACTATCCCCAGATTGTATCA
CCAATGGAAGGCCACATGGGTTCCAGTGCCTGGAGCTATGGCCCCAGCAGCCCATGAGCT
GGTGCTGCCAGCCTTGTTGGACAAGGTGATGACCAGGACTGCCTCTGATAAACCGATTTT
CAAGGCCCTGGAGGTGACATGGTGCAATGGGCTTCCCATGGTGTGGTTTCTGGAGTTGAG
TCAATGAAGAGACCTCATACTGTCTCCAATAGTGATAATGACTTAAAAATCATGCTAAAT
AGGATTACACTGAGGCCCAGCCTAGTGACAGTTTGTCAAGAATATCCTAGGATCCAACAT
GCCTTCCAGGAGAGAAGATTTTGGGGACTGGAGACCCAGAAGCATGCAGACCAGGATACA
GTACTTAGGAGCAGCTGCTCCTGCAGGACTAACCAAACATTCTTACTTGGACTTGGTGTG
TGCTCCAGGCTATTTGAGTTGTGCGGCTGTGTTGAGGGCTCCTTCTTCAGCTTCCTCAGT
CCCCTCATGTCTAAAATTGAGATATGGCTGCCCATCTGGTCACCCTTGTTTCCCAGATCC
CAGGTGACTGGATGGTGAAGATCATGGTTTCTCTATGTGGGAGATGGGTGTCAGTGTAGA
TCTTCCAATGAAAACCTATGAGGTAGACTCACTGAGACACACCGAAGGCAGTCTTTGGGT
ATGCTCCAGTAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCATATGAGACACATTCGGACTACTAC
ACCAGGCAGTGCATTTTTTGGTGGAGCAGCCAGCACTACAGGTGCCTGGCAGCTTGGGAG
CTTCATGTGGGTCAAAGGGCCACTGGAGCCTAGAGCCCAAGGATTCTTGAGCTAGTGTCT
TCATGGGGGTGCCAACACCTGGGCCTTGGTACCTACAGAGTAGAGTCATGTACACCCCAT
GGCCCCATGATAATTTAAAATGCTGACTTTGTTAGAGGATGGTGTTTCAGGATCATGTCG
ACAGACCACAGACTGAGTTGTGCCCATCAAGGATGGGCTTGGCTCTCACTCCCTCAAGGG
AGGCATCAAGGCCCCATGGCACAAGTCAGTCATGGTTCAGCCCAATTACCCTACACTGTT
TTTCAGATGTGTTGGTACCGTGGTGGGCAGTTACAAATGGAGGTAGGTGTTTCTGCAGGA
TACAGCCTGATCTCCCAGAAACCACTGTGCTCTCGCTTCCTACACCCAAGCTCATGGGCC
TGTACAGCAACCCCATATTGGTAGGCCAAAGGCCCTATGAGTTTCCCTTGGGCATGTCTT
TTGGGACCAGTTATCTGAAGTTTAGGCTGGGCCACTGCTTGATTGAACAGCAGGTTCTGG
CTTAGATGTGGGTCTTATGAGCAGGAAGGATTGATGGTTTTAGCCACTGCTGGCAAGAAG
ATCCTGCCTGAGTTTAACTCTCTCAGTGACAAAGAGGCCAAAGGTTTGGGAAAACTTGCC
AGTTTTCCCCACCTACAAGAGTGGGGTCCTAGGAGGACTCACTAGGGCCAATGAGGCCAA
AGAATTCTCTGGAACCAACACACCCTTACCTGGATCTGTTGACTTTTAATACCCATTCGC
CTACTTGTCCCACAGATGATGTCAGCAGAGGAAGCCAAGGGGGCCCAGTACCATGTGGCA
AGGCTGTAGTCTAGGTCTAATGGCCCATGAGCTGTGATTATCAGCCCCATAGGTATAGGA
AACATTGGGACTGCCCATGGTACACCAATCCATCCAGGCCACAGAGTGGGGAAGGTATTA
GTAGCTTCTCTTGCTGTGTTTACTTGGGTTGGTTTGATGATAAGACCTCATACTGTCTCC
AAGTCACATGATAACTTAAAACTCATACTCAATAGGAATACACTGAGGCCCAGCCTACTG
ACAGTAGATCAAAAGTATCCCAGGGTCCACATGAGTCTTCCCAGGAAGGAGAACCTGGGT
ATTGTACACCTGCACACCCCCCAGACCAAGATGTAGCCCCCACATTTGAGTGGTTGCTCC
TGCGGGAACCACCTAAGTTCCTTCCTCCATGAACTTGATGTATGCTCCCTACTGGCCACA
TTGCAGGGCCATGCTCAGGCTTGTTCTTCAGCTCCCTATGCATAGGGATCCATGGTCCAG
CCTAATGCCTCTACCCTACCTTTAGGATGTGGACAGTACTGTGATGGGAAGTGACCATAG
GATGTATGTGTCTCTGGGTGGCATAGCCTTAGCCCCTAGAATTCACTGCTCACACGTCCT
CCAACCTTTTCCCAGGCCTATGCAGTTACCCCATGTTGGTAGGTCCAGGGCACCATGGGT
GTCTCCTTGGATTTGTCTTGTGGGACCAGTCTTCTGATGCTTAGAATGGGCCATTGCTTG
CTTGTCCAGCCTAGATGCTGGATAGGATCTGGATCTTAGTGGCAGGAAGGATTGGTGGAT
GTAGCCTCTGCTGGCAGGATGATCCTGTCCAAGTGTCCTTTTCTGTTCTAGTGACCAAGA
GGCCCAGCAGTTTGCTAGTCACCACTGTGCCTACAGGCTGGGGCTCCTGGGAGGACTCGA
CTAGGCCAATGATGCCAAATTATGTTCTGGAACCTGTGCGCCCTAGTCTATGCCTGCTGT
CTGTTCACACCCAACTGAATGACCAGTACTACCCATGGTAAGCCTATCCATCCATTGAGA
TTCTTAAGTTGGGATGGGTCCAGCTACTCCTCCAAGTGTGTTTAATGAGGTTGGGTCAAT
GATGAGACCTCATACTATCTCGAAGAGAGATGATGACTTAAAAATTATGCTCAATAGGAT
TACGCTGAGGCCCAGCCTAGTGACAGTAGTCAAAAGAACCCTAGGGGCCACACGTGCCTT
TGAGGGGTGATACATAGGAATGTGTGCCTGGAGGTTCCCCCCACTTCTGAATGCAGTTCC
CAGGAAAGAGTGGTTGCTCCTGCTGGATCAGGCCAAGCTTCTTCCTCCTTGGGCATTTTA
TGTGATCCCAACTGGCCAAGTTGTGGGCTCCCTTCATCCCCTTGTTCTTCCAGTGAGATG
TGCTACTTGGAGGGTCACATTTGGGTCCTGGTTCCCAGGTGAGTGGATATCATGGATAAT
GGGTACACTGTGGTGGAACTATATATCATGGACAGTCACTCAATGCAAGCTTTAGGGATG
TACCTTAGGAGACACAAAATGGCAGCCTGGGGGCATGCTTCTGAGTGAGCTGTGCCTATT
TGGTGTCTGAAGTTCAGGACACTCATATCTGAATCTGTGGCAATGTGTGGGAGTCTGGCA
AAGAATAGAACCCATTCCTGATGGAGGGTTCATGCACTTTCAGAGCCGCCTTGTACCTAT
GGGGCTGCAGCATCTCTGTGTTACCCTGTTGGTGTGACCAGCAGTATTCAGACTCCACGG
ATCAGGCATCTCTGAAAGGTGCAGGTTTCAGCTTCCTTAAGAGGTCTAGGCCAAGGATCA
CATTGAGTATAGGAGGGAGACTTGGCAGGGATGCTGGCTATGTAGGTTCAGGTTTCTAGC
AGCCTGGGATCTGCAATTCGGTTGCAGTGCCCCTGGAACCTAGGATGCAGGGATGATCAG
TTTGATGCCCAGTAAGGGAGGATGCAGGCACCTTTGCCATGGCATCTGCAGGGCCATGGT
CCAACCCAATACCCTTATTCCAACTGTGGGATGTGCATGGGACTCAGTAGGCAGCATCTA
TTGGAGAAAGTTTTCTTTGGGGTCCATATCCTGAATTCATGGGATCCAGTTTGTGCTAGT
AGCCTGCACCTGAACCCTCATACCAGGACAATACGGTGTTTGCAGGACCAGAGTGCCCTG
GGGACTCTTTGGGTGAGACTCTTGCCACCACAACTCCGAGCCATGCCATCGCTAGAATGT
TCAGCCAGGGTAAAGGCCTAAACTTGGGCCTCAGGAGAGGGAACGGAACAGTGGACTCCC
AGGTGAGTCCATGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTGTGCCCATTTATGCTTTAAGGTCCAGATACATTGCATGAAC
TCATGGCCTGGTTTGGGGGCCAATTTAAGTATAGCAAGGTTCCTGGGGGATGGTTCACAT
TAAGCCAGTGCCCCCACTTGTCCTTAGTGAGCTTCAGCAGCTCTGGGTTGACTTGCCTGT
TTGGCCAGAATTTGTTGAACTCTAGGGGTCAGGCCTCTGTGTAGGCTCAGGGTTTAGATT
CCCTAGGAGGCCTTAGATGAGAATAACCCTGTTTTTGATGTGTACAGGACTGCAGAGGGC
TGTAACTATGGGTGGAATGTGTCTCAGTTGTACATATTCTGTGTGTGCATGCAGCCAACA
CCTCAACTCCCAGGCCTGAAAGGTGATGCCTTGCTGTTAGGACCCGGGCATGATATTTAG
ACTGGGTCATTGCTTGATTGCACAGCCTTGTTAAAGCATAGGAGCTGGATCTTGGAGCAG
GATGAATTGGTAGAAGTAACCACTGCTGGCAGTATGATTCTCTCCAATTGTCCCTCTCTG
TTCTAGTGACCAAGAAGCACAGCAGTTTGTGGAAAAGGGGAACATAGTTTCAAGACATTG
TCCTGCGTGGTGGATACTGGGAAGGATACACCTGGGCCGATGAAAAGTGACACTCTGGAA
CCTGTGCACCCTCGTCTGCCCTTGCTGTCTATTCACACCCGATGCAATGACAAGCACTGC
CTGTGGTAAGCCAATCCATCTGGGTTCCTAAGTTGGAATGGCTCCAGGGACTCTGTCTTG
TGTGTTTACTGCAATTGGGTCGATGATGAGACCTCATACTGTCTTGAAGAGAGATGATGA
CTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGTGACAGTGGTGCAACA
GGACCCTGGCATTTCCACTTGCATTCCAAGGGAGGAGACCTGGGGACTGGAGACCTGGAG
GTTCCCCTCAGTCCTGAATGAAGTCTCTAGGAAAGAGTGGTTGCTCCTACTAGATCAGGC
CAAGCTCCTTCCTCCTTCTGCGTGGCATGTGATCCCCACTAGCCAAGTTGTGCTTATGTA
CAGAGGCCTCCTTCTTCTTCTCCCTTTGTCCCCTTGTTTTTTTCAGTGATGTATGCTGCC
TGGCGGGTCACACTTGCATCCTGGGTCCCAGGTGAGTTGAATGGGTGATGGAATGGGTAA
TGGTTCCTATGTGGTACAGCTGGTTATCATGGCCAGTCTCCCAATGCATGCTTAAAGGAG
ACACAAGAAGGCAGCCTAGGGCCATGCTTCTGATGGGCCGATCCCTTTTGGAATCTGAGG
TCCAGAACACCTTACCTGAATCCCCAGCATGGTGTGGGGACCTGGCAAGGAATGGAAACC
TTTTGATGGAAGGTTCATGCACTTTCTTTTTTTTTATTTTTTTTTTATTTTTTTTGACAG
GCAGAGTGGACAGTGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTTTGCCATTGGTTCAC
CCTCCAATGGCTGCCGTGGCTGGCGCGCTGCGGCCGGCGCACCGCGCTGATCCAATGGCA
GGAGCCAGGTGCTTATCCTGGTCTCCCATGGGGTGCAGGGCCCAAGTACTTGGGCCATCC
TCCACTGCACTCCCGGGCCACAGCAGAGAGCTGGCCTGGAAGAGGGGTAACCGGGACAGA
ATCTGGTGCCCCGACTGGGACTAGAACCCGGTGTGTCGGTGCCGCAAGGCGGAGGATTAG
CCTAGTGAGCCGCGGCGCCGGCCAGGTTCATGCACTTTCAAAGCTGCCACTGTGTCTATG
GTGGCTGCAGCATCTCTGTGTTGCCTTATTGGTGTGACCAGAAATATTCAGATTCCAGGG
ATCAGGTGTCTCTGAAGGTTCAGGTTTCAGATCCTTAAGAGGTCTGGCTCAGGACCACAC
TGAGGATGGGAAGGAGGTTTGTCAAGGATGCCAACTCTGCAAGTTTCTAGCAGCCTGGAG
CTACAACTGGGTTACAGGGCCCCTGAAACTGAGTATGCAGGGATACTCTGTCTGGTGCCC
AGTGACAGGGGTACAGGCATCAGTGCCATGGCACCTGCAGGGACATGGTCCAGTCCAATG
TCCTTACACCAACTGTGAGATGTGCATGAGACTCAGTAGACAGTGTCCATTGGAGGAAAT
TTTCTTTAGGATCCATAGCCTGAAATCATGGGTTCCAGTGTGTTTCAGAGCCTGCACCTG
AGCTCCGGGCCTGGACAAGGATACCTTGTTGGTACAACCAGAGCTCCCTCAGGGACTCCT
TGGGTGAGACTCTTGCCACCACTCCTCTGAGCCATGCCAGTGATGGAATGCTCAGCCAGG
GTAAAGATCCCAAACTTAGGCCTCTGGGGAATAAAGGAGCATTGAAATTCCCAGGTGAGT
GCATGGTGGGGACCAGTATCTTTGCTATGGATCTGAGTGTCAGTGCAGGTCATCCAAAGC
AAATCTAAGGGGTGGATCCACAGAAACACAGGAGAGTTGACTCATGCTGTACTCAAGAGC
AAGGTGTGCCCATTTGTGCTCTGAGGTCCAGAATGCATTGCTTGAACCCCTGGCCAGGTT
TGGGAGCCAACTAAGGGGATGGCAAGGTTCCTGGGGGATGGTTCTCATCCTAAGTGAGAT
TAGCAGCTCTGAGTTGCCTTGCTCATTTGTCCAGTTGTCATGGAACACTAGGGGTCAGGT
ATTTGTGTGGGTGCAGGATTCAGATTCACTAGGAGGTCTTGGATGAGGCTACACCATGCA
GGGACAGAGGTTTGGTTGGGTAGCAGGCCCTGCATGTTCCTGGCTGCCTGGAAGCTTTAT
ATGGGTCACTAGGACACTGGAGCCATGATTCAGGGACACTGACCAGTACCCAGTTATGTG
GGTGCCAAAACCTTGCCCAGGACACCTGCCAGATGGTGTAAGTCACACCATATCCATACG
GCTTGTCTTGTCTAAGGTCTAGCCTTTGCTGGCCACATGGGTGGACTTTTGACTGAGTTG
ATCTCAGCAAGAATGTCAGGGCTCCTCCTAGGGCCCCTGATTCTGCTCCTTCTAGGGAGG
CAAAAAAAAATGGTATGGGTGAGCTGCAGTCCAGCCCAATACCGGTCCCCCATCTTTGCA
ATATATACAGGACTGCAGTAGCCCATGACCATAGGAGGAATGTGTCTCAGGTGCACACTT
TCTGAACTCTGAGAATCCATTGTGTATATGCAACCAGCATGTAAGCTCCCAGGCCTAAAC
GGAGATGTCTTGTTATTAGGACCAGGGCACCACTAGGGTCTCTTTGGGTGTGTCTCATGT
GACCAGTCCCCTGAGCCCAGTTCCTTGCCACTGCTTGATTATCTAGCCCAGGTCCTGCTG
AATCCTGGGTACTGGGGTCAGGAAGGAGCTTTAGGGGAAGCTGGCTCCAGGAGGGCAACC
TGGTCTGAGTAACCCTCTCTGGACCACTGACCAACAGACCCAGTAGTTTTCAGGCAAGGT
GTGGGGCTTTTCCATCCCCGGCACACCTATAGAGGTGGCTTCATGGTAGGCCTCACCTGG
GCCAATGGTGCCAACATATGCTGTGGAACCAGTGCATCCTGGCCTGCACCAGCTGTGTGT
TCACAGTTCCTCCCAGTCCCACAGATGATGTTACCAGAGGAAGCCTACATGTGTTCCAGT
GCCCTAGAAGCAAGGACTGTTGTCATGGCCCCAGCAGCCTAAGAGTTCATTCTTCCAGCT
CATTTTCCATTAGAAAAGGAGATGTCTGCAACTGCTTGTGATAAGCCAGAAATCTGTGCC
TTGGAGTTGAGATGGCACCAGGGTCTTCTAGTGCTGTGGTTCCTGTGGTTGGGTCAATGA
TGAGACCTCTTACTGTTTTTTTGTTTGTCTGTTAGTTTTTTAACTTTTATAACTTTTATT
TAATAAATATAAATTTCCAAAGTACAGCTTATGGATTACAATGGCTTTTCCCCCCCAATA
ACTTCCCTCCCACCCGCAACCCTCCCATCTCCCGCTCCCTCTCCCATTCCATTCACATCA
AGATTCATTTTCAATTCTCTTTATGTACAGCAGATCAATTTAGACCTCATACTGTCTTGA
AGAGAGGTGATGACTTAAAAATCATGCTCAAAAGGATTACGCTGAGGCCCAGCCTAGTGA
CAGTGGTGCTAGAGGTACTTGGGGTAACCAGGTGCCTTCCAGGGGAGGAGACCCTAGGAC
TGGAGAACTCAAAGCCCCCCTTGGTCAGGACATGATCTTCGGGCAGATCGGCTGCTTGTG
AAGGATTCACACAAAGTCTATCCTCATTGGGTTTGGTGTGTGCTCCCTGCTGTAAAATTT
GCTGTCCTACATTGGAGATTCCTCCCTAAGCTCCTGTATTCCAAAATGTCTTTCAGTGAG
ATGAGCTGTCCTTTGGAGCCCTCTTGGACCAAGTGTTCTAGGTGAGTGGATGGAGGTTGT
AATTGGGCCTGTGTGGGGCGTAGCAGGTGTTCTGGGTGTGTAACCTGATGAAACTGATGG
GTGGAACCACACAGAGACCCAGGAAGGCAGCCTTGGGCCATTGTCTTGGGTGAGTTATGC
TCCTTCAGACTCTGAGGTACAGATCAATGTACTTAAATCCCTTGCTTGTTGAGGGTGCCA
AGTAAGGAATCAAAATGGTCTAGAGTGAGGGGACACGTTGGGCCAGTCCTGTCACTAGTT
CTTATATTGTAGCAGCTCTGGTCTTTCCATGTTGGCAACCATGCCACATCCCCACTACTT
GCCTGATTCAACAGCTGGTATTCACTGGCAACATGAATAGGGTTAGGACTGTGTTGGACC
CAGCAAAGATACCAGGACTCCCACTGGTCCTGGGCTCCTTCCCATGGAAGGCACCCAGTC
CATATGGTAGGAGTGGGCCATGTTCCCACCCAATGTCCATACCATATCACTGGTACATAC
TGGGACTGTTTTGGGCAGCAACTATAGGAGGATGGTGTCTCCATGAGACCCAGCCTGTTC
TCCAGAAATACAATGTGTTCAGGCAGCCTGCACCTGAGCACATGTACCTGTAAAGTCACA
CTGGTGGTTGGCCCAGAAACCACAGTTGTAAATCTTGGGGGACCAGAACTTTGATGCTTA
TGCAGACCATTGCTTATTGGTCCAGTCCAGTTCCTGGCCAGGATCTAGGTCTTGTGGGTT
TGAAGAAGCAATGGTGGTAGCCACTTCCAGCAGGACAATTCTACGCGAATAGGCCTCTTG
GACACAGAGACACCTGTGGGCTCCTGGAAGCCTCACCTGATCCACTGGGGGCATAAGTAC
ACTCTTGTTCCAGTATATACTATTCTGCCCCTGTCGTCTGTTCACACTCATTCACCTTCC
TATCCCACAGATGATGTCACCAAAGGAAGCACCTATGGGGTCCAATGCTTGTAGTCAAGG
CCTCATGGGCCCATGAGCTGGTGGTTGCATTCCCGAGGGTGAAGGAAATATCTCTGATCT
CCTGAGGTAACCTAATCCATTGGGGCACTAGTGGTAGGGCTGCAATATGGGATTTCATGG
TGTGGTTCCTCTGGTTGGGTCAATGATGAGACCTCATACTGTCTAGAAGAGAGATGATGA
CTTAAAAATCATGCTCAATAGGATTACTCTGAGGCCCAGCCTAGCCTAGTGACAGTATAG
CAATAGGACATCAAGGACTCCACGTGCTTCCCAGGGGAAGAGACCCAGGGGACTGTAGAC
CTAAAGACAGTCTGTCGAGGAAGCAGTACCCAGGCAGCAGCTGCTGCTCCTGCTGGATCC
ACCCAAGCTTCCTCCTTGGGCAGGGATGTGTTCTTTGTGGGCTGAGTTGTGGTGCTATTT
TGGGACCCCTTCTCCAGCTCTTTTCATCCCCTTGTGCCTTTCAGTGTTATGTGGTGCCCA
GCAAGTCACCCTTCCATCCCACATCCCAGGTGAATGGATGGTGAGACTCATGGGGCCCTG
CCAAGAATCTGAGGGTATGTGCACTTGTTACCAGCATAAGAGGTAGATCCACAGTGAAAA
ATTTAATCCACCTTGAGCTGTGCTGCAGAACCAGCTGTGCCTGTTTGGTCTCTGGGGTCT
AGAACACCTTGGCTGAAACTCTGGCCTGGTTCAGGGCTCAGCTGGGGGTTGGCAGTGGAT
ACTGGTACAGGGTTCATATGGGGCCATTGACCCCACATGGCCTAGGTGGGCTTCAGTGGC
TTTGTATTGCCATGGGCTAGGAGTGGGCAGATACTCAAAACAGACCCCTTTTTGGGGGAA
TGGCTCTGATTGCATTGGAGGCCTTGGCAGATGACCACAACCAGCAGAGAGGGAGGTTCG
ATGGGAGAGTCAGATCTGCAGGTGCCTAAGGGAGGTTTGATGGGAGAGTCGACTCTGCAG
GAACCTGGCAACATGGTAGCTTCACATGTGTCCCAGGGTTGCTGCATACTAGTACATAGC
ACCCTCAGGGAGTATCCAGTCAGGGGAATTCTAACACTAGCCCAGGGTACTTGTACAGTG
GTGCCCAGCATGCCACATCCCTGGCACTTGCCAGCATTCCCTTTCACATGGTGTCCCTCC
TGGACCTGGGCTCACACTTTTCCACAGAAAGCACCAAGGCCTTCAAATGAAAGATCTGGG
CCAATGTCCATTCCCCATCTTTAGCATGTGTACAGGACTGTGGTGTACAGATACCATGGG
AGGAAGGTGTCTCTGGGGTGCATAGTCAGAGCTCCCAGGGAGCAGTATGTGTCCACAACC
TATATCTTAGCTCATAGGCCTGGCCTGGACAGGAATGCTGTGTTGGTAGTCACAGGACCC
CACCTGGGCATCCTTTGATGTATCTCATGCCATGGGTCCTCTGATACCCATGCCAGCACT
TTCTTGTCAACTCTAAACATGGGCTTGGGAGAAGAAAGAGCAGTGTGGTTAGCCATTTCC
AGCATGGTGACCCAGTCTGAGTTACCATCTCTGGCACAGTGACCAACAGGCCCAGAAGTT
TTTGGGCAATGTGGTGGGATCCTGACTAAAGCAATATGCTTACAGGGGCAGCCTCCTGAA
ATTCTCAACTGGGCCAACAGAGCTAAAGCACGCTTGGGAGCCAGTGAACCCTAGCCTGCT
CCTGTTAGCTTTTCACACCCAACTTCTTCTGTGTCCACAGATGATGTCAACAGAAGATGC
CCATGGGGAACAGACCCCATTAGCAAGAGCTGTGGTCAGGGTCCCAGCAGCCACCAATGA
GCTGATGATGCCAGCCTTGTTGAAGGAGAAAATGTCCAGGATCGCCTGAGGTAAGCCAAT
TCTCCCAGACCTGTGGATAGGATACCTCCCAGGGGTTCTTGTGCTGTGATTCCTGGGGTT
GGGTCAATAATGAGACCTCATACTGTCTCGAAGAGAGATGATGACTTAAAAATCATGCTC
AATAGGATTACGCAGAGGCCCAGCCTTGTGACGTGGGTCAAGGTGACCTTGGGGAAACCA
GGTGCCTTCCAGGGGAGGAGACACTGGAGACTGGAGAACTAAAGGCCTCACAGGCCAGGA
CATAGTACCCACCCTAGATGGCTGTTCATCAGGAAGCACCCATGCTGCATCATCCTTGGG
TTTGTTGTGTGCTACCCGCTGTCTGAGTTGCGTGACCATACTTGCAGCTCCTTTTTCAGT
TCTTTCATCACCTTCTGTCTTTCAGTGAGATGAGTTGCACAGCAAGGCACCCTTACACTC
CAGTTCCAAGGTGAGTGGATAGATGGTATCCATAGGACTGTGTGGGAGAGCAGGGGTTCT
GTTGGGTCACCCAACGTGAACCTCAAGGGTGGATCCATGGAGACACAGAAGGCAGCCTCA
GCATTGTGCCTCCTTGGGTTGATATCCTGAACACCTTACCTGAACTTCTGCCTTATTCTG
TGGTTTAGGCAAGGAATGAAAACATTTCTGAAGGAGGGATCACAGGGGGCCAGTGCTGTA
ACTTGGCCTAGGTGGGCCTCAGTGGCTCTAGGTTGCCTTGCTTTTGTGGCTGGATATGTA
CAGACCCTTGGGAACTAGCTTCTGTGTGGGGACAGGTTTTAGATTAGGTGGAGGCAAGCC
CGTTCCACATCAAGGCAGGAAGAGATGTTTGGAGTGGCAGTGACTATGCAGGTGACTGTC
AGCCTGGGAGATTCATCTGGGTGTCAGGACCACTGGAACCTAGGACACAAGGACTCTCAG
GCTGGTAACCATCCATGCAGGGCTGACATCAGTGTCATGTATCCTGCAGGGTGGTGCCAG
GGATGCATATCCCTGCCACTCACTTTGTCCTGGGGTGGGGGTTATCAGGCCACGTGGGTG
GCACTGAACTGAATTGAGTCCAGCAAGCATGACAGGGGCCCTTCTGGTCCTGGGCTCCCA
ATTCTCCACTAGAGGCACCTAGGCCCCACAGTAAGGGTAGTCCGTGGTCCATCCTAATGC
CTGCACCCTATCTTTGGGATATGTAAGGCACTGAGTTGGGCAGCGACCACAGGAGGAAGG
TGTACCCAAGAAGCATAGCATGAACTCCAGGGATATAGTCTGTACATGTAGGCTAGACCT
GAGTGCTGGGCCTGTATAGCAAGGACTTGATGTTAGGCCCAGGGCCCTATGGGGGCCTCC
TTGAGTGTATCTCATTCAACTGGTTCTTAGGCCAGTTCTGTGCCAGTGCTTGATTGCTCA
GCCCAGTTCCCGGCTGAAACCTATGGAATGAGGTCAGGAGATAGTGGAGGATGCTGGCCT
ATGACCAAGGGGCTTAGCACTTCTCAGTTAAGGTAGGCAGAGCTAACCTGATACCACCAT
GCCTACAGTGGTAGCAACCTGACAGGATTCACAAGAACCAACAGTACCTAAGCACATTCT
GGAACCAGTGTGCCCAGAGCATGCACCTGCTGTCTATTCATACTTGCCCCCTTGCTGTCT
CACAGATGATATCACCAGAGGAAGCACCCGTGGGTTCCAGTACCCAGGTGCAAGGGCTGT
GGTTGGCCCTAGCAGCCCATGAGCTAGTGCTGCCAGCCCTGTTGTACAAGGCTATGACCA
GGCTTGCTTGTGGTAAGCCAATCCATGCAGGCCCTGGAGGTGGCATGGTGCCAAGGGTTC
CTATGTTGTGGATCCTGGGGTTGGGTCAATGATGAGACCTCATACTGTCTAAAAGAGAGA
TGATGGCTTAAAAATCATGCTCAGTAGTTTTACATTGAGGCCTAGCCTGGTGACATTAGT
CAAGAGAATACTGGGGTCCAACCTGCCTTCCAGGATAGGAGACCCTGGGGACTAGAGACT
TGGAGGCCCACAGGCCAGGATGCCGTCTCCAGACAGGAGTGGCTGCTTCTACAGTTTTTT
TTTTTTTTGGACAGGCAGAGTGGATAATGAGAGAGAGAGACAGAGAGAAAGGTCTTCCTT
TGCCGTTGGTTCACCCTCCAATGGCCACCGTGGCCGGCGCGCTGCGGCTGGCGCACCGCA
CTGATCCGATGGCAGGAGCCAGGTACCTATTCTGGTCTCCCATGGGGTGCAGGGCCCAAG
CACTTGGGCCATCCTCCACTGCACTCCCTGGCCACAGCAGAGAGCTGGCCTGGAAGAGAA
GCAACCGGGACAGAATCCAGCACCCCGACCAGGACTAGAACCCGGTGTGCCGGCAACGCA
AGACGGAGGATTAGCCTAGTGAGCCGTGGCGCCGGCCTTGCTTCTACAGTTTTTAATCAA
GCTTCTTCCTACTTGGACTTTGTGTTTGCTCTCATGATGATTAAGTTGCACCGCCTTGTT
TGGGCCTTCTTCAGCTCTCTTCTCATCCTCTTGTCTCTTTCAGTGAGATGTGCTTCCTGT
TGGTTCACTCTTTTTTTTCGCAGGTCCTAGGTAAGTGGATGGCAAAGATCATGGGGTCTC
TATGTGGGATATGGGTGTCAGGGTTGATCACTCAATGAAAGTCTTGAGGAGTGGATCTAC
TGAGACACATGATAGCAGTCTTGGGCCTGTTATNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAG
CTGCTTTTGGTTGCCTTGCTGATTTGGCTGGGATTGGGCAGACAGAAGGTATCAGGCCTT
TTTGTGGGGGCAAGGCTTATCTCCCAAATGAGTCTCATAAAGAAGAAAACACCAAGAAGT
GAGTTTGGTGTATCAGCCAGCTCTACAGGTGCCTGGAAGCCTGGGAGCATTATGTGGGTC
ACAGAGCCACTGGAACCCAGGACCCAGGGACGCTCTAGCCAGTGCCCTGTCAGGGAGGTG
CCAACACCAGAACCATGGCACCTGCAGGGTGGTGCCCTGCACATCCATGCCCAATGCTTG
CCTCATCTAGGGGCTGGAATTTGAGGGCCACATGGATGGGCTTTGGATTGAGGTGTGCCC
AGCAAGGATGACAGTTCACCTCCTGGGTTGGGCTCCCACTCCTCCATGGGAAGCATCAAG
GCCCCAAGGTAGAAGTGGGCCATGGGCCATACCAATGTCCCTACCCCATCTTTGGGTGTG
TTGGAGGAAGATGTTTCTGCAGGGCACAGAGTAGCAATAGGAGGAAGATTCTTCTGCAGG
GTACAGCCTAATCTCCCAAAATCCAGTGTATTCACAAAGCCTGCTCTAAAGTGCACAGAC
CTGCACAGTGACCCCATGTTGGTAGGCCAAAGGCTCTACAGAATTCCCTTGGATGTGTTG
TGGGCCAGAATTCTGATGTTTAGGCTGGGCCATTGCTTGCTTGACCATCCTAGTCCTGGC
TTGGATTTGGGACCTGGGGGCAGGAAGAATTGGTTGATTTAGCCACTACCAGAAAGAAGA
TCCTGCCTGATTGTCTCTCTCTGTCCCAGTGACCAAGAGGCCCCACAGTTTCTGGCAAGG
TAGATGAAACTTGCCAGTCCCCATACCACCTACAGAGATTTGCTCCAGGGAGGACTCACC
TTGGCCAACATGGCCAAACCACACTCTGGAATCAGCATACCCTTGCCTGGTCTTCCTGTT
TGTTCACACCCAATACCCTTAATGTTCCACAGATGATGTCAGCAGAGGATGACCAGGGGA
CCCAGTGCCACATGGGCAAGGACTGTGGTCTAGGCCTAGTGGCCAATGAGCTGGGAGCTT
CAACTTCATGGGTGTAGGAAATGTCTAGAACTGCCCATGATAAGGTAATCCAACCAGGCC
ATGAAGTTGGAATGGCTCCAGGGACTTCCCGTGCTGTCTCCTGGGGTTGGGTTGATAATG
AGACCTCATACTATCTCAGAGAGAGATGATGACTTAAAACTCATGCTTAATAGGATTACT
CAGAGGCCCAGCCTACTGAAAGTTGGTCAAGTGTATCTCAGGAACCGCATGTGCCTTCCA
AGGAAGGAGAACCTGTGTGCTCAGGATGTAGTCCCCAGGCATGAGCAGCTGCTCCTGCTG
AATCCACCCAAATTTCTTCCTCCTTGGTGTGGTGTGTGTTCCCTGCTGGCCAATTTTAGG
GTGTGCTGGGGACTTCTTCTCAGGTATCTTCATCCTTTTGCTTCTTTCAGTGAGATGTGC
TAACCCTAGGTCACCCTTGTTGTCCTGGGTCCTGGATGTGTAGATGATAAGAATAATGGG
GCCTCTATATGGGAGCTTGGTATAAGGGCAGTCACCCAATGAAAGTTTGTGTAGTGGTCC
CAGATAGACACAGGAAGGTAGCCTCTGGCCATGCTCCTGGTTGAACTGTTCCCCTTTGGG
CTGTGATGTCCAGAACACTTTACCTGAACCTCACCATGGTGCAGGGGCCAGACAGGAATA
GAAACGATTCCTGAGGGAGAGTTCACATGCTGTCAAAGTTGCCACTGTGTCTAGTGGGTC
TTCAGCATTTCTGTGTTGCCTTGGTGGTGTGACATGAAGCAGGGAACACTGGGCAACATG
CTCCTCTGAAGGTGCAGGTTTCAGATTCCATAAGAGGTCCAGGCCAAGGACCATACTGAG
AATGGCAGGGAGGTTTGATGGGTTACCAGCTCTGCAGATGTTGGCAGCCTAGGAGCTTCA
CATGGGTTGCAAGATCCCTGGATCCTAGGTTGCAGTAATATTCAGGCCCATGCCCAATAA
AGGAGATGCAGGCATCAGTGCAATGATAGCTACGTGGCTATGGTCCAACCCAATGCCCGT
GCCTCAAATGTAGATGTGTATGAGATTCAAAAGGCAGCATCCATAGGAGGCAGTGTTCTC
TGGGGTTCGTATCCTGAACTTCTGGGATCCAGTGTGTGATTTCAGCCTGCACCTGAGACC
CTGGGCCTGGAGGGGGATGCCATGTTAGTTGGATAAGAGCTCCCCTTGGAACTCCTTTGG
TGTGTCTCATGCTATCAGTCCTCTGATGCCAAGGCCATGCCATCACTCTCATGTCCAGCC
TGTGTAATGGACCAATCTTGACCCTCTGTGGAATGAAGGAGTGGTAGAGGTAGCTGCTTT
GGGCAGGGTTTTCCAGCCCGAGTGGCCTTGTCTGCCCCAGTGACCAACAGCCAAGCAGTT
TCTGAGTGAGATGATCAGAGATTTCCTGACTCACCATGCCTAAAGGGGTGTGCTACATGG
AAACTTCTCTGGGCTGTGAAGTCTAACAACATTCTGGAACCAGTATACCCAGAGCCTGGC
ACATGCTGTCTCTTCATATTCAACCACATCCTTGTGCCATAGGTGATAGCAGAGGAAACA
CATGTAGGATTTAGTACCCCTAGGGTAAGGTCTGTGGTCAATACCCTAGTTGCCCATGAA
CTGGTGGTACCACTCAATTGGCAAAGGAATCAACCCAATGGCCCAAGGTAACCAATTCCA
TTTGTATTTTAGGGGTGGGATGGCACCAATGGGTTCCTGTGGTGTGATTCTTGGGATTGG
GTCGATAATGAGAACTCATACTGTATCAAAAAGAGATGATGACTTAATCATATTTAATAG
AATTATACTGACGCCCAACATAGTTACATTGGTGCAAGAGAACCTCAGGGTTTCCATGTG
TCCTCCAAGGGAAGAAACCTATGGGATGGTGTCCTTGAGGCCCCCATGCAGGACCCAATC
CCTGTATAGGAGCAGATGCTCCAGCAGGATTTACCCAAGCTTCTTCCTCCTTGAGCTTCA
TGTGTGCTCCACTCTGACTGAGTTGGGGGAAGTGCTATGGGCTCTTCCTTCAGTTCCTTT
CATCTTCTTGTCTTCTTCAGTGTTGTGTACTGCCCAGCAGTTTACCCTTACATCCTAGTT
CCCAGGTGAGTGCATGTGTCAGGGTGGGTCACTCAAAGAAATCCAGAGAGGTGGACCCAC
ATAGACACAGGAACACTACCTCAGGCTGTGCTGTAGAGCAAGCTGTGTCTCTTTGGGCTC
TGAGTTCCAGAATGTGTTGCTCAAACACATGGCCTGGTTTGGGGAACAACTAAGAAAGGC
AAGGTTTGTAAGGGAGGGTTAACATGGGGTTAGTGCCCCCACTTAGAGTAGGTGGGCTGT
AGTGGCTATGGATTGCCTTGCTGTTTTGGCCAGAAGTTTCAGAATCTAGGGCTGAGAATT
GTGTGTAAGGGCAAGTTTAGATTCCCTATGAGGCCTGAGATGAGGGCAACAGTAAGGGAA
GGAGGGAGATTTGGTGGGGAAGCAGGTTTTGCAGGTACCTGGCAGTCTGGGAGCTTCACA
TGGGTTATGAGGCTGTTGGAACAATGATTCAGAGTATTCCAACCAGTGCCCAGTTATGGG
TATGTCCAGCACCCTCAGTGTGAAACATTCTTGACTCCCCACGAGCACTATGTCAGGCTT
TAGAAGTGGGACAGTATCAATGAGATCACGTGGTATGTGAGTCTGGGAGGTTGGGTCGAT
AATGAGACCTCATACTGTCTTGATGAGAGATGATGAATCATCTAAACATGATGATCATGC
TCAACAGGTTATGCTGAGGCCCAATTTAGTGACTGTGGTGCAAGAGGAGCCCAGGGTCCC
CACATGCCTTCGAGGGCAAAGAGACCTGGGAATGGAGATGTTGAGGCCTCTAGACATGGA
TACAGTCCCCAGGGAGGAGCAACTGGTGTGTACTCCTTGCTGACTGAGTTGCAAGCCAAG
CTGGGGGCTCCTTCATCAGTTCCTTTTGGCCCCTTGTCTCTTTCAGTGAGATGTGCTTCC
TGACATCCCAGATGTTGGATGCTGAGGATCATTTGGTTTCTAAGGGAGATCTGGGGATCT
GGGCGCATCACCTATCACTAGTGTAAGGAATAGACCTTGAATACGCAGGATAGCAGCCTT
GGCAGTGCTCTAGAGCAAGCCATGCCCCTTTGGGTTATGAGGTCTAGAACGTCTTGCCCA
ACCACCTGGCCTGGTGCAGGAGCCAACTGAGGGTTGGCAATGGATCCTAAGGGAGTGTTC
ATGTATGGCCAGTGGGCTGCATTGGCTCTGTGTTGCCTTGCTGCTTTGGCTGGAATTGGG
CAGATACTGGGGATCAGGCCTCTGTGCCAGGGCAGGACTCCCATTCCATAGGAGGCCCAG
GTGGATGAACACACCCAGAAATGAGGGAGGTTTGGCAGGGAAGATGCTCTACAGATGCTT
GGCTGCCTGGGAGTTTCACATGTGTCACAGGGTCACTGTAATCTATGATGCATTGCCCTG
ACAGTGGGGTTCTGACACCTAGAACACATATACAGTGGTGCCTGGGCATGCCCCCTCCCC
AGTGTTTGCCTCATCCAGGGATTGGCATTAACTGTCACATGGGTGGTTTTGATCTGAGTT
GAGCCTACTAAGGATTGCAGTTCCCCTTCTGGTCCCAGGATCCCACACCTCAATGGAATG
CACGAGGGTTCCACAAATGAATGATCCATGGTCCAGGCTGATGCCCCTTCCTTTAGGATG
TGTATCAGACTTTAGTAGGAAGGAAGAGACCATAGGAGGAAGGTGTCTGTGGGGTGTATA
TCCTGAGTTACCAGGATGTGGTGTGTGTACACAGCCTACACCTTAGCACCCAGATTGGAC
AGGGATGCCGTCTTGGTAGGACCAGGGCACCAAGAGTGTCTCCTTTGATGGATCTCATGC
CATTAGTTCTCTGATACCAAGTCTGTGCAATCACTTTATTATCCTGCCTTGGTCCTAGAC
TGGACTCATCTTGGGTTAAGGAAGGAGCAGTTGGGTTAACCCTTCTGGCATGATGACCCA
GCCTGAGTGGCCTGTTCTGGTCCATGAACCAACAGGCCCAGCAGTTTTCCAGCAAGGTGT
GTGGAGCTTGCCAGAACCAAGACACCTACAGAGACTGCCTCCTGGAAAGCCTCACCTGGA
CTCATAGAGCCAAAGAACACTGGAAACAGTGCACTCTAGCTTGCCCCTGTTGTTTCCTCA
CACCCGAACCCCTCCCTAACCCAGAGATGATGTCAGCAGAGGAAGCCACCATGGAATCCA
AACCCCATGGCAAGAACTATGGTCAAGGACCCAGCAGCCCATGAGCTGATAGTGCCAGCC
ACGATGGAGAAGCAATCATTCAAGACTGCCCAATGTAAGCCAATATATCTACATCCTATC
AGGGGACAGCATCCAAGGTTTCCCATGGTGTGGGTTCTGGGACTGGGTCGATGATGAGAC
CTCATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACACTGA
GGCCCAGCCTAGTGACAGTGGTCAAGAGGACCCCAGAGTTTCTACATGCCTTCCAGGGCA
GGAGACCCTGAGGACTGGAGATCTTGAGACCACCCCCCCAGGCCAGGACACAGTCCACAG
GCATTAGCAGGTGCTTGTGCAGGATGTACCTAAGCACCATCTTCATGGGGCTTGGTTTGT
GCTCTCTGCTGTCTGAGTGGCAGGGCCTCAGTGAAGGCTGCTTCCTCAGCAACTTTCATC
CCCTTCTATCTTTCAGTGAGTAGAGTAGCACGGCAATGCACCCTTCCGAGCTGGGTCACA
GGTGATGGTGATAGTAATGGGGCCTTCGTGGGGTTCACCTAACGCAAATCTCTGGTGTGG
ACCCATGGAGACACAGGAAGGGCCTTGGACAGAGCTTCTTAGTGAGCTATGGCTTTGAGA
TCTGAGTCCAGAGTACCTTACTTACCTGAACCCCAGCCTTGTGTGGGGATTCAGACAAGG
AGTAGAAATGTTTCCTGAGGGAAAGGTTCATATGGGGCCCAGTGCTGCCACTCAGGCTAG
GTGGTCCTCAGTTGCTCTGAGTTGTCTTGCTGGTGTGGAAGGAAGTGTCCAGACACTGGG
GAATAAGACTCCTTGTGGGGAGGGCAGGTTTAAATTCAGTGGGGGCCTGGATGAAGGCAC
CAAGGAAATGAGAGATTTGAGGGGCAGAATAGCAGGTGACTGTCAGCTTGGGAACTTCAG
GTGACAGGGCAGCTGGAACCTCAGACACAGGGAAGTTCAGGCACACCCATACCCACTGCT
TGCCTATTCCAGGGCCTGGCATTTCTGGCATTGTGGGTGGCCTTGGTGTGTGTTGGTCCT
ATCAAGGGTGCCAGGGCCCATCCTGGTCAAGAGCTCATACTGCCCCATGGGAGGCATCAA
GGCAACATGGTAGGGGTTGGCTATGGTCCAGCCTAATGCTCATACACTGTCTTTGGAATG
TGAACAGGAATGAGTTGAGCAGCAACCACAAGAGGAAGGTGTATCCTAGAAACACGGCAT
GAACTCTGGGAATACAGTATGTGCACATAGCCTAAGACCTCAGTTCCTGGGCTTGGATGA
TGATGTCTTGTTGTTAGGCCCAGGACCCCATGGAGGCCTCCTTGGGTGTCTTGTTCAACT
GGTCCTCAGTCCAATTATATGCTAGGGCTTGATTGTCCAGCCCAGGTGCAAACCAAAACC
TTGGTCCTGGGGTCAGAGTAGATCAGTGAAGGATGATAACCTGTGACCAAGAGGCCCAGC
TGTTCTTGAGAAAGGTGGAGAGAACTTACCTGACCCCGCTATGCTTACAGGGGTAGAATT
CTGGGAAGACTAAAAAGGGAAGATGGGGCCAAGGCATGCTCTAGAACCAGTGTACCCAGA
CGTGCCCCTGCTGTCTGTTTATACCCACCCTCTCCATGTCCCACAGATAATATCACCAGA
GGAAGACTTCCTGGGTTCCAATATATGGGGGCAAGGGCTGTGGTGAAGGCCCAGCAGCCT
ATGAGATGGTGCTGACAGCACTGTTGGACAAGCCACATGGGTACCAGGTGACTAGATGCA
GAAGATTATGGGGCCTCTGCAGTAAAACTGCACAATTCTATGCTACCACTTAATTTTCTC
TCCCTGATTTTGGCAAGATCCTGGGTATTGGAATCAGGAAGGAGCTTTGGGAGAATCTGT
TTCATATAGGGAAGTTGGGCCCGAATACTCCTCTCTGGACTAGTGACCAGTAGTATCAAC
ATTTCTTTGGCAAGGTGGCAGAGCTTCTCTGACTCCACCACACCTATAAGGGTGGCCTCC
TGGGAAGCCTCACCTTGGCTGAAGGCATTCAAGCATGCTCTGGAGCCAATGAACCCTAGC
TTGCCCCTGCTGTGCATTCACAACCTCTTCCTCCCAGTCCCACAGATATGTCACCAGAGG
AAGCCTGCATGTGTTCCAGTGCCCCAGAGACAAAGGTGGCGGTCAAGACCCAGCATCCCA
CGAGCGGGTACTACCAGCTCCATTGGAAATGGATATGTTCACAAGAGCCCAGGTAAGCCA
ATCCATCTGGGCCCTGGAGGTGGGACATCAGCAAGGGCTTCCCATGGTTTGGTTCCTGAG
GTTGGGTTGTTGATGAGAACTCATACTGTCTCAAAGAGATGATGACTTAAAAATCATCTT
CAATAGGATTATGCTGAGGCCCAGTCTAGTGACAGTGGTGTAAGAGAACCTTGTGGTAAC
CAGGTGCCTTCCGGGGGAGGTGACCATGGGGGCTAGAGACCTCGAGGCCCTCAGGCAAGG
ACGTGATCTGCAGGCAGGACTGGTTGCTGTGCAGTCTTCTCCAACCGTCTTTCAGTAGGA
TGAGCTGCCCAGTAGAACACCATTGACCCCTCTAGGTGAGTGAATAGAGGATGTCATTGG
GCCTGTGTAGGGCAGAAGGTGTTCTGGGTGGGTTACAGTACGTGTGTCTGCTATTTGGAA
CCACATAGACCCAGGAAGATAGCTTTAAGCCATGCTCCTGGGTGAGCTATGCCTCATTAA
GCTCTGAGGTGCAGATAAACTTACTTGAAAATATTGCCTGTTAAGGGGGCCAAGAGAGGA
ATGCAAAGGGTTCCTGAGAGAGAGGTCACATGGGCCCTCTGCCACCACTCTTCCTAAGTG
GGTTGAAGCAGCTCTGAGGAAATGTGGGTGAGCATTTAGGATGAGGCCACAGAGGGAGGG
CAGGGATGAGATTCACAAGGAGACCCAGGCTGAGAACCATACAAAAGCAATGAGGGAGGT
TTGGCAGAATAACAGGCTCTGGAGGTCCCTAGCAGCCTGAGAGTTTTACGTGGGTCACAG
AGCCATTGTAGCCATGATTCAGGGACACTCCAGCAGGTGCCTATTTGGGGGGTGCTGACA
CATGGTCCGTTGTACCTGCAGAGTGGTGCCAAGGCATGCCGCATCCCTGCTGCTTGCCTC
TTCTAGGGGCTGACATTCCCAGGCCACATGGGTTGGCTTTGGAATGAGTTGAGCCCACAA
AGGATGAGAGGGCCCCACCTGGGCCTTGGATCCTGCTCCTCCATGGGAGGCACCAAGGCT
GCACAGTGGGAGTTGCCCACGGCCTGCCCTCTGCCCATACCCCATTGTTGGGACGTGCTT
GGGACTGAGGTGGGCAGCAAACATAAGAGGATGGGGTCTCTGTGGGGCCCAGCCTGACCT
CTCAGGATACAGTGTGTTCAGGCAGCCTGCAACCTGAGGGTCTGGGCCTGTGAGGTGACA
CTGTTGGTTGGCCCAGGGTCCCACAGTGGCCTTCCTTGGGTATCTCTCATGGGAATGGAG
ACTTGATGCTTGAATCAGGCCACTCTTTGCTTGTCTAGTTCTTGACTAGGACTTGAGTCT
AAGGGGTGTGAAAGAGCAGTGGGGGTAGCCCCTTCTGGTAGGCCATCCTACCAAGTGTCC
CTCTCTGTCACAGTGACCAAGAGGTCCGACCAAGTTTGGTGGAGCTTGCCTGACCCACCA
TGCCCACATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGATGATGTCACCAAAGGAAGCA
CTGGTGGGGTTCGATATCTCCAGGGGCAATGGCTGTAGTCAAGGCCCTAGGGGCCCATGA
GCTGGTGGTACCAGCTCCACTGGTGAAGAAAGCATCCCTAACTCCCCTATGTAAGCCAAT
CCATTAGGCCCTAGAGAGGGGAATATGCCAATGAGATCCTATGGTATGGTTCCTGGAGTT
GGATCTGTGATGAGACCTCATACTATCTCAAAGAAAGTTGACAACATAAAAATCATGCTT
AATAGGATTACACTGAGACCCAGCCTAGTGACAGCAGTACAAGAGGATCCCATGGCACAC
ATGTGCCTACCAGGGCAGGAGACCCTGCAGACTGGAGTCATTGAGATCCCAGGCTGGTAT
ACAGTCCCCAGGGAGTATCAGCTGCTCCTGCAGGATCCACTCAAGCTTCTTCCTCCTTGG
GCTTTATGCTCCCTTTTGGTCGAGTTGTGTTCTGTGCTGAGGGCTCCTTCTTCAGCTCCT
ATTGTCCTCTATTCTCTTTCAATGAGATGTGTGCTGCCCTGTGTCCTGGTGAATGGATGC
TGAGGATCACTTGGCCTCTGCAGGGATCTGGAGGCCTGGGTGAGTTACCTGTCATGAACA
TAAGGAGTGGACTCATGGACACACAGGATGGCAGCATCATGAAGTGCTCCAGAGCAAGCT
ATTCCCCCTTTGAGCTCTGAGGTCTAGAATACCTTACCCAAACCTTTGGCTTGGTGTAAG
GGACAACTGAGGATTGGCAATAGATCCTGGGGGAGGGTTCATGTGTGGTCAGTAGCCCCA
CTTGTCTTTGGTGGGCTGCAGTGGCTCTGGGTTGACTGTTTTGAGATTGGGCAGGTATTG
GGTGTCAGGCCTCTGCTGGCTTCAGACTTGGATTCCATAGGTGGCCTGGATAGACAACCA
CACCAAAAAATGACAGTTTCATGTGGAAGCATGCTTTGAAGGTGCCTGATAGTCTGGGAA
CTTCACTTGTGTTCTGGGGTCACTGCATCCTAGGACGGAGGACCCTCAGGCATTTCTCAG
TCAGGGAGATTCTGGCACCAACCCAGGGAACCTGTATAGTGATGTCTGACATGCCCCATA
CCCTATGCTTGTGTTCCCTTTCACATGAATGGGATTTCCTCTGTGTGGAGCCTACTAAAA
ATGCAAGGGCCCCTCCTGGTCCTGGGCTCCCACTCTTCCATTGGATGCATCATGACCACA
CTAATGAATGATCCACAGTCCAGGCTGATGCCCCTTTCCCATCTTTGGGATGTGTACAGG
ACTCAGTGTGCAGAGACCATAAGAAGAAGATGTCTCCAAGGTGCATATCCTAAGCTCCCA
GGATGCAATGGGTGTACACACAGCCTATACCTTAGTGCCCAGAGTGGATGGGGATGCCAT
GTTGGTTGGAGTGGGGCCCAAGTGGTGTCTCCTTTAATGGGTCTCATATCACCCATCCTC
TGAATCCAAGTTTGTGCCAGTGCTTTCTTGTTTAGTCCAGGTCCTGGTCCTGACTTGGGC
TCAAAGGTAAAGGAAGGAGCAGTGGGATTATCCACTTCCAGCATGGCAACCCAGCCTGAG
TTTCCCTCTCCAGCCCGGTGGGTAACAGGCGCAACAGTTTTCCATCAATTTTGGCGGGGC
TTGCCAAACCAAGATGCCTACAGGGACAGCCTCAGGGAAGCCTCACCTGAGCCAATGAAA
ACAAAGCATGCTCTGTAACCAGTGCACCCTAGTCTGCCCTACTATCTGTTCACACCCATC
CACATCCCTATCTCACAGATAATGACAGCAAAGGAAGAACCCTGGGGTCCAGGGCTCAGA
AGGCAAGGGTGTGGTCAAGGCGTAGCACCCCAAGAACTGATGGTACCAACTCTGTTGCCA
AAGTAATTGTTGTTCTGGTAAGCCAATCTCTCTGGGCCCTGAAGGTGGGATGGCACCAGG
GACTTCCCATGGTGTAGTTTCTGGGGTTGGGTCAATGATGAGACCTCATACTATCTCGAA
GAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACACTGAGGCCCAGCCTGGAGGC
AGTGGTGCAAGGGGAATTTGGGGTAACCAGGTGCTTTCCAGGATAGAAGACACTGGGGAC
TGGATGCAGTCTGCAGGCACGAATGAGTGTTTGAGCAGGATGTACCCAAGCTCTATCTTT
CTTGAGCTTGGTATGTGCTCCCCACTGTCTGAGACTGGGTCCACACTAGGCCCTCCTTCC
TCAGATCCTGTTGTCCTCTTTAGTCTTTCAGTGAGTAGAGTATCCTGGCAGGGCACCCTT
TTGACCCTGGTCCCAGGTGAGTGGATGGTGGTAGTAATGGGGTATATGTGTAGCAGCTGG
TGGTCTGGGTGGGTCAACAGATACTAACCTCAGGGGTAGACCCATGGAGACACAGGAAAG
CAGACTCAGGCAGTGCTCCTGAGTGAGCTGTGTCCCTTTGGGCTCTGCGGATCAGAATGC
TGTACCTGAACTCCTGCCTTGTATAGGGAAATATTTACCAAGAGAGGATTCATGTGGTGC
CAGTGTTAGCCTCGGTGGGCCTCAGTGGCTCGGGGTTGCCTTGCTGGTGTGGCCAAAAGT
GGGGAGACACTGAGGAACCAGCCTCTGTGAGAAGGCAAGTTCTGGATTCAGTGGAGGTCT
GGGCCAAAGACAACAAAGCAGGGAGGGAAGCTTAGAAGGTCAGGAACTATATAGATCGCT
ATCAGCCTGGGAGCTTCAGATGGGTGGCCAGGCCACTGGAGCCTAAGACAAAGGGATGAT
CGTGTTGCTGCCCATTCAAGGGTGCCACCACAAGTGCCATGCTACCTGTATGGTGGTACC
AGGCATTCTCTGCCCCATAGCTTACCTCGTCTAAAGGCTGCCATTCTCAGCCACATGGGT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCTGGCCCAGCTACCAACAGGCCCAGCAGTTCTCTGGTAAGGTGGGCAGAGCTAGCC
CAGTATCATCATGCCTACAGAGTTAGTATCCTGGAAGGACTCGCCAGAGCCAATGATGTC
AAAGCACAATCTTATAACAGTGTACCCAGAAGTTTCCCCTGCTGTCTGTTCATTCCCAGA
CCCTCTCTGTCCCACAGATGGTATCAACAGAGGAAGCCCCTTGGATTCCAGTTACCTGAA
TCCAAGGCTATGGTCAAGGCCCCAAAGGCAATGAACTGGTACTGCCAGTCATGTTGGACA
TGACAACGACCAGGACTGCCCATGGTAAGCCAATCTACCCGGGCCCTGAAACTGATATGG
TGCCATGGGGTAGTTCCCAGGGTTGGGTCGATGATGAGACCTCATACTGTCTCGAAGAGA
GATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGTGACAATG
GTGCAAGAGGACCCTGGGGCTTCCATATGCCTGCCAAGGGAAGAGACCATGGGGACTGGA
GACCTTGAGGCCCATAGGCCAGGACACAGTCCTCAGGCAGGAGTGACTGCTCTAGCATGA
TTCATCCAAGCTTCTTCCTCCTTAAGCTTGGTGTGTGGTCCCCTCTGACTGACTTACAGG
CCATGCTATGGGCTCTTTCTTCAGCTCCTTTCATCCTCTGTCTCCCTCAGTGCGCTGTGC
TTCCTGGCAGTTCACCCTCATGGCACAAGTGCCAGGTAAGTTCATGGCTGGGGTCATGGG
GCCTCTGTGAGGGAGCTGGGTATCAAGGCAGGCCACCAAATGAAGCCTGAAGGGTAGAAC
CACAGATAGACAGGAAGGCAGCCTTAGGCAGTGCTCCAAAGTGAGCTCTTAACCTTTGGG
CTCTCAGGTCCAGAATGCCTTCCCCAAGTCCCTAGCCTGGTTTGGTGGCCAACTAAGGGA
TGGCAATGGTTCTTGGCCAATGTTCAAGTTTAGCCAATGTCCCCATTTGTCCTAGGTGGG
CCTGCAGGAGCTCTGTGTTGCTCTGCTGGTTTGGCCAGAAGTTGGTGGACACTTGGGGTC
AGGCCTCTGTGGGCAGAAGGGGCTTATTTTCCCTAGGAGGCCTGAGATAAGTACCATAGC
AAGGCAAGGAGGAAGGTTTTCTGGGTCAGCAGGCTCTACAGGTGCCTGGCAGTCTGGGAG
CTTTAGATGGGTAGTGGAACTGCTGGAGCCCTGATTCAGGGACATGCCACCCAATGCCTG
GTCAGAGGATTGCCATACCTGGTCCAGGGTACCTGCATAGTGGTGCCAGGCATATCCCAT
CTCTGCTGCATATCTTTTCTAGGGGCTGGCCTTTGCAGGCTATGTGGGTGGGCTTTAGAT
TGAGTTGAGCCCAGCAAGGATGCCAAGGCCCTCCTGTAGCCCAATTCCTACTCCTCCAGG
GGAGGCAACAAGACCCCAATGTAGGGATGGGCCGTGGTCTAGTCTGATGCTGGTACCCCA
TCTTTGGGATATGTATGGGACTTTGAATGGCAGTGACCACAGGAGGAAAATATCTCCAAA
GGGTAGTTCCTGTGCTCTAGGAATCAAATGTGTGCATGCCAGCTGCATTTGAGAACCTGG
GCTTGTACAGTGACACCTGTTGTTAGGCCCAGTGCATTACCAGGGCCTCCTTGGGTGTGT
CTCATGTGAGCAGACCTCTGAACTCAATTGGGTGTCATCACTTAGTTGTCCAACCTGGGT
ACTGGCTGGAACCTAGGTACTGGGGTCAGAAAGGAGCTTTAGGGGAAGCTGTTTCCAGTA
GGGCAACCTAGTCCAAGTAACTCTTTCTGGACCAGTGGACAACAGGCGCAGCAGTTCTTG
GGCTAGGTATGTGGAGTTTGTCTGGCTCGACCACACCTACAGGGGTGGCTTCCTGGGAAG
CCATACTTGGGCCGATGGAGCCAATGCATGCTCTGGAACAAAGGCACCCTAGCCTGCCCC
TGCTGTGTTTTCACACCTCCCTCCTCCCAGTCCCACAGATGTCACCAGTGGAAACCCTGC
TAGGGTACCAGTGCCCAACAAAAGGACTGTGGTCAAGGGCCCTGTGGCCCATGAGCTGGG
GTGCCAGCCATGTTGGAGAAGGAAACATCCATGACTGCCCAAGGTAAGACAATCAATCCA
GGCTCTGGATGTAGCATGGTGCCTTGTGCTTCCCGCAGGGTGGTCCCTGAGGTTGGGTCG
ACGATGAGACTTCATGATGTCTCGAGGAGATGATGGCTTAAAAATCATGCTCAATAGGAT
TACACTGAGACCCAGCATAGAGACAGTGGTGCAAGAGTACCCCAGGGTACCCATGTGCCT
TCTAGGGTACCCGGGGGGATGGAGACCTCAAGGCCATCCAGGCCAGGATGCGGTCTGCAG
CAGGAACAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGGGGC
CGCAAGACTCCAGGGGGGAACAGAGCCATGGTGCAGACCGATATCCTCATGTCACTTGCA
TATATGTCCGCACTTCGCTAAACAGTGGTCATCGGGAGATGACGTATATGGGCGCCAAAG
CTCAAGCTAGCTCTGCTCAGCGTCCTGATGACTCCTGTACCTCTTGGTCACTGTGACAGA
CAGGCCTACTCAAGCAGCATTGTCCTGATGGAAACACCTCTATGGTGACACCATGTTGGT
TGTCCAGGGCCCGGGCTGATGAGGAGGGGTACTCCTTGGGTATGTCTCATGGAACCAGAA
CTCCGATGCTTAGGCCAAGCCATTGCTTGCTTGTCCAGTCCAGTTCCAGGCCATAACCTG
GGTTTCAGGGGCAGGAAGAAGCATTAGGAGAAGCTGCTTCCATCAGGACAATGCTGCTTG
AGTAGGCCTGTCTGTCATAGTGACCAAGAGGCCCAGCAGTTTTCAGGAAGTTCAGCAGAG
CTTGCCTGACCCACAGTGCCTATGTGGGTGAGCTCCTGGGAAGTCTCACCTGGGGCAGTG
GGGCCAAGCATGCTCTGGAGCCTGTGTATACTAGTCTGCCTCTGTTGTCTGTTCACACCC
ATTCACCTACCTGTCCTACAGATAAGGGAGGTTTGGCACAGCAGTGGGCTCTGCTGGTAC
CTGGCAGCCAGGAAGCTTCATGTGTGTTATGGAGTCGCTGAATCGTAGGATACAGGACCT
TCAGACAGACCCTAGTCGGGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNATATGGTTCCTTGGTTGCCGATGGTGAGACCTCATACTGTGTCA
GAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGTG
ACAGTGGTGCAAGAGGACCTTGGGGTACCAGGTGCCTTCTGCAGGGAGGCCCTGGGGTTG
GAGACCTCAATGCCCCTCAGGCAAGGATGCCACCCCCAGGTATGAGAGGCCGCTCATGCA
GAAATTGCACAAGCTCTTTCCTTACTGGGCTTGGTGTGTGCTCCCCGCTGTACGAGTCAC
AGGGCTACGCTGGACGCTCCATCCTCAGTCCTTTCGGTCACTTTTGTCTTTCAGTGAGAC
AAGTTGCCAAGCGGGGCACCCTTGTACTTGTGGTGCTAGGAAAGAGGGTGTCATTAGGCC
TGTGGGGGGGCAGCAGGGAGTCTTGGCAGGTCACCTGTCATGAGCCTGAGGGGTGTACTC
GTGGAGACCCAGGAACACAGCCTCGGGCATGAGCTATGCAACTTTAAACTCCATGTTGCA
GATCAACTTATGTGAAGCACTTATGTGGCCTGTTTAGAGGGGCAAAAGAGTAATGGAAAT
AGTTCCTGAGGGAGGTGTCACATGAGGCCAGTGTCATCACTTGGCCTAAGTGGGCTGCAG
CCACTCTGGGTACCTTGCTGGTATGGACAGAAATGGGCAGACACTGGAGATCAGGACAAT
GAGTAGGGGCAAGGCTGAGATTCACTAAGGGACCTGAGCCAAGGACCACACTGAGGCAGC
CAGGGACATTTGGCAGGGCAGCTGGCTCTGCAAGTGCCAGCAGTCTGGGAGCTTTATGCA
GTACTTAGGGCTGCTAGAACCTAGGCTGCAGGGAAGTTCAGCCTAATGCCCGGTAAATGG
GGGGGGATGACACATGGGCCATAGTACCTGCTGAGTGGTGCCAAGCAGGCCCTTTCCTGC
TACTTGCCTCATCCAGGGGCTGGAATCCGCATCCCACGTGGGAGGGCTTGGACTTAGTTG
AGCCGAGCAGGGATGCTAGGACCCTTCTAGGTCCCAGGCTCCCACTCCTCCCTGGGAGAC
ACTAAAGTCTCATGAAATAATGGGCCATGGTCCAGCCCTGTGTTTGACCCCATCTTTGAG
ATGTGTATAATTCTGAGGTGGGCAGTGACCATTAGAGGAAAGTGTTTCCAGGTTGCACAA
CATCAGCTCCTGGGATGCAGTGTTAGCACACAGTCTGCACCTGAATGACAGCCTTTACAA
AAACACCATATTGGTTATCCCAGTGTCCCATGGTGGACTACTTGTGTATGTCTTGAGGGA
CCACAATTCTGATGCTTAGGCTAGGCCTTGCTCATTTGTCCATTTCAATTCCCAGTCAGG
AACTGGGGTACTTGAAGGCAGGAAGAAGTGGTAGGGGAAGCACTTCCAGTAGGACGATCC
TGCCCAACTGGCACTCTGTCCCAGTGTCCAAGAGTCCCAGGTGTTTGTGGGCAAGGTGGG
CAGAACTTTCCCAACACTACCACACTCAGGGCTGGGTACCTGAAAAGTCTCACCTGGGCC
TAAGGGGCCAAAGCATGCTCTGGAACCACTGTATCCTAGTCTGCCCCTGCTTTCTGTTCA
CCCCTGTCCCCTTCTCTGGCCCATAGATAATGTCACCAAAGGGAGCTCCCTTGAGGTCCA
GTGCTCCTGTGCAAGGGCTATGGTCAAGGCCTCAGCAGCCTCATGAGCTGATGGTGCTAG
CCCTATTGACAGAGGAAGCATTCAGGACTGCCTATGGTAAGTCAATCCATCTGGGCCATG
GGGAGTGGCATGAAGAGGTTAATGAGGCATGATTGTTGGACTTGGGTCGATGATGAGACC
TCATATTATCTTGAAGAGAGATGATGACCATGCTATCTGTTCACACCCATTCACCTCCCT
GTCCCACAGATGTTACCAGAGGAAGCTCCTATGGGGTCGAGTGCCCCAGGGACAAGGACT
GTGGCCAAGGCCCCAGGGACCCATGAGCTGCTGGTTCCCAGACCACTGATGAAGGAAATA
CACCACAATCTCTGAGGTAAGTCAATCCATTGGGACACTACATGTGGGTGGCATGAATAG
GATCCTATGATATGGTTCCTGGGGTTGGGTCGATGATGAGACCTCATATTGTGTCAGAGA
GAGATGATGACTTAAAAATTGTGCTCAATAGGATTACAGTGAGGCACAGTGTAGTGACAG
TGGTTCATGGATTGAGAGGACCCCAGTGTTCACACATGCTTTCCAGAGGAAAAGAACCTT
TGAACTAGATATCTCAAGCCCTCCCCGACCCCAGGACAGAATGCAGTTCCCAGTCAGGAG
CAGCTGCTCTTCTGGATCCACCAAGCTTCCTCTTCCTTGCACTTGGTGTGTACTACCCAC
TGGCCGAGTTCTGTGGCCATGCTGGGGGCTCCTTCTTCAGCTCCATTTCCCCCTATTTCT
TTCAGTGAAATGAGCTGCCCAGTGGGTGACTCTCGAGTCCCAGGTCCCAGGTGAGTTGAT
GGAGGGGTCATGGGGCCTCTGTGGGGGAGCTGGATATCAGGGAGGGTCACCCAATGAAAG
CCTAAGGCGTGGCCTAGGGAGACACAGAAGGAAGCCTTGGGCCACACTCCTGAGCAAGCT
GTGCCCATGTTGGCTCTGAAGTCCGGAACAGCTTGCCTGAACATATGTCCTGGTGCTAGG
CCCAAGTGAGGAATGGAAACAGTACCTGAGGGAGGGTTCATGAGGGGCCAGTGCTGCCCC
TCAACCTAGGTGGTCTGTAGAGGCTCTGGGTTGCCCTGCTGCTTTGGCTGGAAGTGAGCA
CACACAGGATCAGGCCTGTGTATGCTGTGGGTCTTAGATTCAGTCAGAGGCCTGGCCTGA
GGACCACAGCAAGGCAGGGAGAGAGGTTTGGTGTGGCAGCCAGTTCTGCTGGCACATGAC
CACTTGGAAGTTTCACATGGGTCACAGGGCCTTGGACCCTAGGCACATGAATGCTTTGGC
TGATGCCAGATCAGGGGTTGCTGACAACTGGGCCTGGGAAACTTCAAGGTGGTGCCAAGC
AGACCCCATATCCACCTCTTGCCTCATCCAGAAGATGGCATTCACTTGCTCCATATGTAA
GACTTGGATCAAGTTCAGCCCAGCAATGATGCCAATGGCCCTCCTGGGCCTGGACTCCCA
CTCCTTCATGGGAGGCTTCAAGGATGCAAGTTGGTGGTAGGCCATACTCCAGCCTGATGC
CAGCATCTTTTGGATATATACAGGACTGCAATGGGTAGTGATCATAGTAGGAAAGAGTTG
CTGGGGCACAGCTTGAGATCCTGGGATCCACTGTGTGCATGCAGCCTGCACTGAGCACAC
TAGCTTGAAGGCAACACCATATTAGTAGGCCCAGGGTCCCCCAGGTCCTCTTTTTGTACA
TCTCTGCCACCAGTCCTCTGACACCAAGGGTGGTCAGCACATACCTGTCTAGCTTGGGTT
CCAGAATGAAATTAAGCTTCAGGGACAGGAAGAAGTGGTGGAGGTAGCTGCTTCTGGCTG
GGTGACTCATCCCAGTTGGCCATCTCTCGCCCAGTGATCAACAGGCCAAAAATATTGAGT
CATGGAAGGGAGAGCGTGAACCACCATGCCCACAAGGGTGGCTCGCCTAGGTGGACATGG
CCAAATACACTCTGGAACAACACTACACGGATCCTGCCACTGCTGTCTTTTCACACCTGG
TCCCCACACTGTCCCACAGATGATGCCAGCAGAGGAAGCACCCTGGGGTCCAGGGCATGG
AGGGCAAGGGCTATGATCAAGGCAGCGGTAGCCATTGATATGCTGGTACCAGCTCTGTAG
CAGAAGGAAATATCTGGGACTGCCAGTGGTAAGCCAATCCATCCAGACCTTGGAAGTTGT
TCTGCATCAGGGACTTCCTATGGAGTGGTTCCTAGGATTGGGTCAATGATGAGAATTCAG
GTATCTTGAAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGC
CTAGTGACAGTGGTGCAAGAGGATCCTGGGATAACCAGGTGCCTTCCAGGGGAGGTGACC
CTGGGGACTCAGAGATCTGGCAACCCTCAGGCCAGGATGCATCTGCAATCAGGAGTGGCT
GCTTGTGCTGAATTCACCAAAAATCCATCTTCCTTGGACTTGGTGCGTGCTCCCCACTGT
ATGAATTGTGTGGCCCTCTTGTGGCTCCTTCTTCAGCTCCTTTCTTCCCCCTCTGTCTTT
CAGTGAGCATAGTAGCCCAGCAGGACACTCTTTTGACCCAAGTCACAGGTTAGTGGATGA
CAGTGGTAATGGGGCTTATGTGCTCCACCTTGGGTTCTGGCCTCAGGCTCTCACTGCTCC
ATGGTGGGCACCAAAACCCCACCATAGGGGTGGAATATGGTTCAGCCTAGTGCCTGTACC
CCTAGTGCCTGTACTGCTCCATGGTGGGCACCAAAGCCCCACCATAGGGGTGGAATATGG
TTCAGCCTAGTGCCTGTGCCCCTTCTTTTGTGTACAGGCCTGAGTTGGGCAACAACCACA
GGAGAAAGTTGTATCTGAGAAGCATAACATGAACTCCAGGAATGCAGGTTGTACATTTAG
CCTAGACCTGAGCACCCAGGACTGGTAGGAACACCATGTTGTTAGTCCCAGGACCCCATG
GAGGCCTCCTTGGGTGTGTCTCATTCAACCAGTCCTCAAGCCACTTTGGTTCCAGGGCTT
GGTTTTCAAGCCCAGGTCCAGGCCAGAACCTTGGTATTGGGGTAGGAGGGAGCAATGGTG
GATGCTGGCCCAGGGACCAAGAGGGCTAGCAGTTCTTGGGTAAGGTGGGTAGAGCTTGAC
CAAACCCACTATACCCACAGGAGTGGAATTCTGGGAAGACTCACAAGGGCAGATGGAGCC
AAAGCATGCTGCATCAGTATGCCAAGAGTATGCCCCTGCTGTCTCTTCATATCTGCCCCC
TCCCTGTCCCACAGATCATATCACCAGAGGAAGAACCATTGGGTTCCAGTGTATGGGGGC
AAGGGCCATGGTCAAGGCCCAAGCAGCCCATGAGCTTATTGTGCCAACCCTGTTGGACAA
GCCAATGATCCATACTGCCCATGTAAGTCCATCCACCTGGGCTTTGGAGGTGGGATGGTG
GGATGGGCTTTCCATAGAATATTTCCTGGGGTTGGACCGATGATGTGACTCATACTGTCT
GGAACAGTGATGACTTAAAAATCATGCTCGTGCTCACTTTGGCAGCACATATACTAAAAT
TGGAATGATACAGAGAGGATTAGCATAGCCTCTGCTCATGTATGACATGTGAAGTGTTCC
ATATTTTTAGATGAAAAGAAAATCATGCTTAATAGGATTATGCTGAGGCCCAGCCTAGTG
ACAGTGGGTCAAGGGGATCCCGTGGACCACACATACCTTCCTGAGGAGGAGATCCTGGAA
ACTGGAGACCTGAAGGCCCCCAGGCCATGACACAGTCCCAGATGGGATGGGAGCAAATGC
TCATGCAGGACCTAACCAAGTTTTTTCATCCTTGGGCTTGGTGTGTGCTCCAAGCTGACT
GAGTTGCAGCTTACTTCATCCCCTTGTCTCTTTCAGTGAGATGTACTGCCTGTCCGGTCA
CCCTTGTGTCCCAGGTTCCAGGTGAGTGGACAGCGAGGATTATGGCGCATCTGTGGAAAA
ACTGGGTATTGTGGCAAATCACTTAGTGAAAGCCTGAGGCGTAGACTCACAGAAACACAG
GAAGGCAGCCTTGGTCTGTGCTGCAGGGTGAGCTATACCACTTTGAATTTTGAGGTCAGA
ACCCCTTTTCTGAACTCCTGGCCTAGTGTGGGTGGCAGTGGATCCTGGGGATGGATTCAG
ACGGGGCCAATGTCCCCAGTTGTCCTACATGTGCTGCAGTGGCTCTGGGTTGCCTTGCTT
TTTTTGTTCTGTGGTTGGGAAGATACTGAGGATCAGGCCTCTGTGAAGGGTGAGGCTCTC
CATGGGGGGCCCAGGTGGATGACCACACCCAGTAGTGAGGGAGGTTTGGCATGGTAGCCC
ACTCTGCCAGTTTCTGTCAGCCTGGGAGCTTCACAAGTGTTTCTTGGTCATTGCATCCTA
GGACACAAGAGACTAAGACATTACCCAGTTAGGGGGCTTCTGACACCTAGCCCAGGGCAC
CTGTCCAGTGGTGCCTGCCATGTCCAATCCCTGGTGCTTGCCTCATCCAGGGGCTGGCGT
TCACTGTCACGTGGATGGTCTTTGGACTGATTTGAGCATACTAAGGATTCCAGGGCCCCT
CCTCTATGGGATGCACCAAGGACCCATGAACAAATGATCCATGGTTTGGACTGATGCCTC
ACCTCCATCTTTGGGATGTGTACAGGACTGTGGTAGGCAGAGACCATTGGAGGAAAGTAT
GCTGGGTTCATAGCCAGAACTCCAGGGATGCAGTACATGTCCACTGCCTACAGTTTAGCA
CCCAGGACGGGACAGGGATGCCATGTTGGTAGGAGCATGTTGGTAGATGCCATGTTGGTA
GATGACTGGGTGTGGTCATCCACCTGGGCCCCCCATGAATGAGCCTCACCCTTCACAGAG
GCCTGATCCTCAGTATCTTCCCAACCACAGAACAAAAAAAGCAAGGCAACCCAGAGCCAC
TGCAGCACATGTAGGACAACTGGGGACATTGGCCCCGTCTGAATCCATCCCCAGGATCCA
CTGCCACCCACACTAGGCCAGGAGTTCAGAAAAGGTGTTCTGACTTCAACTGGTGCCTCC
TTTGTTGTTTCTCATGCCATCTATCCTCTGATACCAAATCTGTGCCAGCCCTTTTTTATC
CAGCTCAGGTCTCAGCCCAGAATGGGGCTTGGGGAAGGAAAGAGCAGAGGGATAAGCCAT
TTCTGGCATTTTGACCCAGCTTCAGTGGCCCTCTCTGGTCCAGTGGCAAACAGGCCAAAC
AGTTTTCCAGCAAGATGGGCAGGGCTCACACAAACCAACACCTACAGGGACATCATTCTG
GGAAGACTCATCTGGGCCAACAGTCAAAGAACACTCTGGAACCAGTACACCTTAGCCATC
ACCTGCTCTCTGTTCACACCTGACCACCTTGCTATCCTGCAGAGGATATCAGCAGAGGAT
GCCACATGGGGAACAGCCCCCATGGCGAGAGTTGTGGTCAAGGCCCCAGCGGCCCACGAA
CTGATGGTGTCAGCTATGTTGGAGAAGGAAATGTCCAGGACTGCCCAAGGTAAGCCAGTC
CATCCAGGCCCTATCAGTGTGACAGCTGGCAGGAATTCCCATGGTGTGGTTCCTGAGGAT
GGGTCGATGATGAGACCTCATACTGTCTTGAAGAGAGATGATGACTTAAAAATCATGCTC
AATAGGATTACGCTGAGGCCCAGCCTAGTGACAGTGGTACAAGAGGACCTTGGGGTAACC
AGGTGCCTTCCAGGGGAGGAGACCCTGGGGACTGGAGACCTGGCAGCCACAATGCCAAGA
CTGGGAAGGCTGCTCATGCAGGATGAATCCAAGCTCCATCTTCTTTGGATTTTTTGTGTA
ATCCCCACTGTCTGAGATGTGGGTCCAGGCTTGAAGCTCCTTCCTCAGCTCTTTTTCATC
TCCTTCCCTCTGCCTTTCAATGAGAGGAGCTGCACAGATGGGTACCTTTTCACCGTGGGT
TCCAGGTGAGTGTATAGAGGGTGTCAGTGGGCCTGTGTGGGGCTGCAGGGGCTCTAGCCA
GGTCACCTGAAGCAAACCTGAGGCATAGACCCGTGGAGACACAACAAGGAAGACTCAGGC
TGTGCTCCCGAGTGAGCTGTGCCCCTTAGGGCTCTGAGGTCCAGAATGCCTTTCCTGAAC
CTCAGTCCAGGTGCAAGATCAGAGTGAGGAATGGAAATGGCTCCTTGAGGATGGTTCATG
GGGGGCCTGTACCCGACTTGTCCCAGTTGGGCTGCAGTTTCTCTGGGTTGCCTTGCAGGT
ATGGCCAGATGAGTGTAGACACTGGGGATCAGACCTCTGTGAGGCAGTGGGACTCAGATT
CCATAGAAGGCCTAGGCTAAGGACCACACTTCAGCACCGAGGTGGGTTTGGCTGGGCAGC
TGATTCTGTAGATGTCTAGCAGCCTGGGAGCTTCATGTGGGTTGCCTTTGGACCCTAGTG
GGTTGGAATTCTCCAGCTAGTGCCTGGCTGGGGGGATGCCTACACCCTGGCAAGGTCAAC
AGTATGGTGCTGCCTGTTATGCCCATTCCTGGCACTTTCCATGTCCAGGGGTTGGTTTTC
ACTTGCCACATGGGTGGTCTTCGGATTGAGTTGATCCCAACAAGGATGCCAGAGGCACTC
TTGGACCAGGCCCCTGTCCTCTACTGCAAGGCCCCGCAGCCCATGGGCTGGTGGTACCAG
CCACGTTCCCAGAGGAAACATCCAGAACTGCCAGTGGTAAGATAATCCTTCTGGGCCCTA
GATGTGTGATGGTGCCTATAGCTTCACATTGGGTCAATGATGAGACCTAATGCTGTCTTG
AAGAGAGATGATGACTTAAGAATCATGCTCAATAGGATTACGCTGAGGCCCAGCTCGTGA
CAGTGGTGCAGGAAGACCTTGGGGTAACCAGGTGCCTTCCATGGGAAGAGACCCTGGGGA
CTAGAGACCTTGAGGCCCCAAGGCCAGGGTGTCCACAAGCAGGAGAGGCTACTCATGCTA
GATTTGTACAAGCTCATTCCTCACTGGGCTTGGTGTGTTATCCCTGCTGTATGAGTTGCT
GGGCTGCACTGAGAGCTCCTTTCTCAGCTTCTTTCTTCCCCTTCTGTCTTTCAGTGTGAT
GAGCTAAACAATGGAACTCCTCTGGACCAGGAGTTCTAGGTGAGTGGATGAAGGTTGTCA
TGGGGCCTGTGTGGGACATCACTGGGTCTTAGTTGGTCACCTGATGTGAGCCTGATGGGT
GGAACCAAGAGACCCATGAAGGAAGGCTCAGGCTATGCTCCAGAGTGAGCTGTGCCTCTC
TGGGCACTGAGAATCAGGGTGACTTACCTGAACCCCTGGCCTGTTTGGGGCCAAGAGAGT
AATGGAAATAGTTCCTGAGGGAGGGGTCACTTGAGGCCAGTGCTGCCCCTTGGGTCTAGT
TGGGCTGCAACAGCTCTGGTTGCCTTGCTGGTGTGGGAAGAATTGACCAGGCACCGGAGA
TCAGGCCTCTGAGCAGTGGTAGGGCTGAGATTCACTAGGAGACCGGTGCCAAGGACCACA
CTGAGGCAGTAAGGGAAACTTCAAGGCTCTAAGGCTGGGGTGTAGTCCCCATGCAGTTGC
TCCTGCAGGATACACCCAAGCTTCTTCCTCCATGGTCATGGCGTGTGCTCCCTACTGGCC
AAATTACAGGCCAGCACTGGGGGCTCTTTCTTCATCTCCTTTTGTCCCCTTGCCTATATA
AGTGAGATGTGCTCTCCGGCATCCCAGGTGAGTAGATGTTGAGGATCACTGGGCCTCCAA
GGCAGAGCTGCATCTGGGCGAGTTATCTGTTTTGAGCCTAAGGGGTGGCCCCATGGAGAC
ATAGGAAGTTGGCCTCAGGCTATATTCAAGAGCCAGCTGTGCCCCTTTGGGCTTTGAGGT
CCAGAATGCCTTAACTGAACTCCTGGCATTGTGTAGTCCAACTGAGGTTTGGCGATAGAT
CCTGGAGGCCTGGCAGCTCCCAGTGCCCCATTTGCCCAGGTTGGGCTGCAACAACTCTGG
ATTGCCTTGCTGGTGTGGCAAGACACTGGGAACAGGCCTCCATGTGGGACAGCTCTCAGA
TTTGGTAGGAGGCCTAGGCTGAGGACTATATCATGCACAGAGAGAGGTATTGGCAGGTCA
TCTGGCTCTGTAGGGGCCTAGCAGCCTGGGAGATTTAAGTAGATTACAGGACCATCTGGA
CCCTAGGATGCAGGGACCCTCCAGCCAGTGCACAATAAAGTGGTTGCCTATACTTGGCCA
AGGCACCTAGATGGTGATTCCAAACACACCACATCCCACCACGTGCCTAATAGATTGGCT
GCATTCATGGGCCACCTGATTGGGCTTTGGACTGAGTTAAACCCCACAACAAAGCTAGGG
CCCCCTGGGCCTGGGGTCCTTCTCCTCCACGGAGGCATCAAGGCCCCATTGATGGTGAAG
GCCGTTGTCCAGCCTGATGCCCAAACCCCATATTTGGAATTTAGTAGGCCATACAAAGAA
GGAACCTTCAGGGTACCCAGCCTGAGTTACCAGGTTCTAGTGTATACACACTGCCTGCAC
CTGAATACCTAGGGCCTGGACATGCACACTGTTTTGGTAGATCCAGGGCACCCTCCAAGA
AAATTATTGAGTGCATCGAGTCCACTGGTCCTGTACTGCTAATACCCAGCTAGCATTTGA
ATGTCCAATCCAGATATAGGGCATCTGGGGTAGGAAGGAGTGGTAGGGGAAGCCAATTCC
AGCAGGACAACATGGCATGAGTATCTTTCTCTGGCCCAGTGACCAACAAGCCCAACAGTT
TGTGGGTGAGCTGGACAGGGCTAGCCTGGACCACCACGCCTATAGCAGTGGCCTCCTGAG
AAGCTTATATGGGATGATGGGTTCAAAGCACACTCTGGAACCAAGGCTTCCAGAGACTAG
CCCTACTGCCTCATCTTTAGGATGTGTACAGGACTGTGGCTGGAAGAGTTGCTGGGACTG
GGGGGGGGGCATGACCTGAGATCCTGGGATCTACTGTGTACATGCAGTCTGCAACTGAGA
ACACTAGCCTCAAAGGCAACACATTGTTAGTAGGCCCAGAGACTCCTGTGGCTCTTTTTG
TACACCTTGTCCCACCAGTCCTCTAACACCAAAGACAGACAGTGCATGTTTGTCCAGACT
GGGTCCTAGCTCAGTATGTCTTCAGTGGCAAGAATGAGTGGTCGGGGCAGCTGCTTCTGG
CAGAGTGACTCAGTCAAAGTGGCTCTCTTCTGTCTAAGTGACTAACAGGGCCACACTCTT
GCTGCTTGTCTCAGTCGGGGACTTTTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAAGGGACCAAGGCCGCACAGAAGGAGTTAGCCTGGTACAGCAGATGCCTG
TACCCCACTACTAAGACATGTTCAGGACTGAAGTGGATAGCAAACATAGGACAGGGTCAC
CACTGGGCCCAGCGTGACCTCCCAGGATACAGTATGTTTAAGCCGCCTGCCCCTGAGGGC
CTGGGCCTTTGAGGTGACACTGTGTTGGCAGGCCCAGGGCCCCATGGGCCTCTCTCTGTT
TCACTTGTTGGGCTGGAATTTTGATTGCTGGAACTTTAGTTGCTTGTCCAGTCCAGCTTC
TGGCCAGGACATGTGTCTCCAGAGCTTGAAGGAGCAGTGGCGGCAGCTGCTTCCAGTAGG
ATGACACTGCATGAGTGGCACTCTGTCCCAGTGATTGTGAGCCCATCAGTTCTTACGTAA
GGTAGGCAGAGCCTGCTGCACCCACCATACCTACAGGGGTGGGCTCCCAAGAAGCCTCCC
CTGAGCCAACGGGGCCAAAGCACATCCCCGGTGAGAAGAGTTGCCCAGCCTGGCAAAATT
TCAACCCAGGAACCTGGTGAGTGGATGGAGGGTGGTGTTAGATCTCAAGGTCAGCGGATG
TTGTGGGCAGGTCACTCTACTCAAGCCAAGGATCAGACCCACAGAGTCACAGTTAGGCAG
CCTTGGGCAGTGTTCTTGAGTGAGCTGTGCCCCATTGGGCTCTGGAGGTCTCTATAACTT
TCCTGAACCCCTGGCCTGGTGCAAGGCCCAAGCAAGGTACAGCAGTGGTTCCTAGAGCAG
GTTCACATGGCGCCGTTGCTCCCACTTTTCCCAGATAGACTACAGTGTTTCTTGATTGCC
TTGCTAGTATGGATAGATGTGGCCTGACACTGGGGAACAGGCAGCTGTGCAAGGGCTGGT
TTTAGATTACCAAGGAGGCCAAGGCGGAGGACACCTTGGCAGAAAGGGAGGTTTTGCAGG
GCAGCCAGTTCTTTAAGTGCCTGGGAGCCTGGGATTTTCATGACCACTGGACCCTAAGAT
GCAGGGACTGATGCCCACACTCTGAGCTATTTAGACTGGGCCAGGGCACCAACAATGTGC
CAGGTACTCTACATCCCCACTGTTTGCCTTGTATATGGGCTGACAACAAAGGCCATGTGG
GTAGAAATTGGGCAGAGTTTAGCCCAGCAAGGATGCCAGGGTTCCTGCTCTTCCACGGGA
GAAATCAAGGTCCCACAGGATGAGTGGGCCATGACCCATCCTGATGCCCGTACCCCATCT
TTTAGTTGTGTACATGATGGTTTTGGGCAGCAACCCTAAAAGAAAGTTGTCTTTGGGGGC
ACAGCTTGAGCTCCAAGGATCTGAAGTGTTCACGCAACCTGCACCTGAGTTCCGCGGCCT
GTATGGTGACTCTGTTGATAGGGCCCAGGGCCCTCAGGGTGCTCCTTGGATATGTCTCAT
GGGAAATTGCCCTCTATGCAGAGCCCAGGCCATCATTTATTTGTCCCTCCCAGGTTCCCA
AGTCTGGTGTGGGGTTTCAGGGGTAGGAAGGAGCAGTGCAGGTAGCTGGTTCTAGCTTTT
CTATCGTGCCCAAGTGGCCCTCTCTCTCCTATTGACAAGAGGCCAGCATCTCTTAGGCGA
TGTGCCTGGAGCCTGCCAGGCCACAATACCTACAGAGATGGGAATCCTCACCTGAGCCAA
CAAGTCCCCAGGCACACTGTAGAATCAGTGCACCCTAACCTGACCTTGCTATCTATTCAC
ACCTGTCTGCCTCCCTGTCCCACAGGTGATGCCATCAAAGGGAGGCCCTGTGGGTTCTAC
TGCCCCAGGGGCAAGGGCTATGCTCAAAGCCCCAGTGGTCCATGAGCTGCTGGCACCAGC
ATTATTGGAGATGGAAACATCCAGGACTATCCAAGGTAATGCAATCCATCAGAAACCTGG
CCCTGGAATGGTGCCAGGGGCTTCCTTTGGTGTGGTTCCTGAGGTTGAGTTGATGATGAG
AACCCCATGTTATCTTGAAGAGAGATGATAACTTAAAAATCATGCTCAATAGGCTTACAC
TGAGGCCCAGCCTAGTGACTGTGGTGCAAAAGCACCTTGGAGTAACCAGGTGTCTTCCAT
GGGAAGAGACATGGGGAAGTAGTAACTTCAAGGCCCCCCAGGCCAGGATGCAGTCCCAAG
GTAGGGAATAGTTGCTCCTGTAGAATCTACCCAAGCTCCAGCTTCCTCCTTGAGATTGGC
GTATGGTCTCCTCTGACCAAGTTGTAGGATTGTTCTGGGGGCTCCTTACTCAGCTTCCTT
TGTTCCATTGTCTCTTTCAGTGAGATGTGCTGCACCGTGGGGCTCTGTTCATCACAGGTC
CCAGGTGAGTAGATGGAGAGGAGAATGGGGCCTCTATGGGGAAGCTGGGTATCAGTGTGG
ATCACTGAACACAAATCTGAGGAGTGGACCCAAGGAGATACAGAAAGGCAGCCTTGGGCA
GTGCTCTGGAACTGGCTGTGCCCTTTGGGTTCTGAGGTCAAGAACATATTGCTCGAACCC
CTGGCCTGGTGCAGGGGCAAATTGAGGGATGGTAATGGATCCTAAGCTAAGATCCACATG
GTGCCAGTGCCTCCACTTGTCCTAAGTGGGCTGCATAATCTCTGAGTTGCCTTGTTGGTT
TAGCCAGAGGTGGGAGGACACTAGGGTCTGTGTGTGGTAAGTTCATATTCTATAGGATGC
CAGGACCAAAAACCACACTAAGCAATAAGGGATGTTTAGTGGGACAGCCTGGTCTGCAGG
TGCATGGCAGCCACGGAGTTTCACATGGGTTGTGGGATCTCTAGAACCTAGCATGAAGGG
ATGCTCTGGCCAGTGCTTGCTCATACAGATGCCAGGGCATCTGTACAGTGGGGCCAGACC
TGTCCAATCTCCATTAGATGCTTCTTCCTGGGGGCACATGGTTGGGCTTCAAATTGAGTT
GAGCCCAGCAATGATGGCAGGGCCACTGCTGTGCCTGGGCATCAGCTCCTACATGGCAGG
CATCAAGGCCCCAAGGGAGGAGAGGACATTTGTGCATCCTGAGCCCAAAACTCATTTTGG
GACTTTGGTGGGCAGCAACCATAGGAGGAAGGTGTCTTCGGGGTACACAGACAGTGATGC
CAGGTTCCAGTGTGTGCATACAGCCCGCATCAGAGCACCAAAGCCTGGAATGGCATGCCA
TATTGGTAGATCAGGGCCCCATCAGGGACTCCTTGAGTGCACCTCATGCGACTGGTCCTC
TGATGACAAGGTGCTGCCCATGCTGGCATGTCCAACCAGGTTATTGGCCCAGACTTGGGC
TTCTTGGGTCAGAAGGAGTGGTACAGGTAGCAGCTTCCTGCAGGTTAATCCATACTGAGT
GGCCTTCTCTGGCCCAATGACCAACATGCCAAGCAGTTTATAGGCAAGGTGAGCAGAGCT
TAGCAGACTCACTATGCCTACAGGGGTGACTTCCTGGAAAGCTTCACCTGGGCCCATTGA
TTCAAATCACAAGATGGAACCAGTGTACTCAGAACCTGCCCCTGCTGTCTATTCACAAAT
TACTACCTCCCTCTGCCAGATAAGATCAGCAGAGGAAGCTCCTGGTGGGTTCCAGTTTAC
CTGGGGCAAAAGCTGTGGTTAAAGTGCCACAATCCATGAGGTAGTGCTACCAGCCCCATT
GGCAAAGGAAACATCGCTGACTTTCCAAGGTGTGCCAGTCCATCCAGGCCCTCCACATAG
GATCACCCTAGTGGCTTCTGCAGGTGAGTCCTGTTGGAGTAGCCAATCCTGGGTTTGGGT
TTGGGCTAATAATGAGACCTCATTGTGTGTCGAAGAGAGATGATGACTTAAAAATCATGC
TCAAAAGGATTACCCTGGGGCATGGCCTGGTGACAGTGGGTCAAGAGGAACATGAGGTCC
ACAAGTGCCTTCCAGGGGAAGAGAGCCTGGGGCCTGGATACTTTAAGACCCCCTGGACAG
GGTGCAGTTCCCAGGCAGGAGTGGCTGCTCCAACAGGATTCACTGGAACTTCCTCCTCCT
TGGAGTTGATGTGTGCTCCTTCTTTAACTCCTTTCATCTTTAGTCTCTCTTCAGTGGCAT
TTGCTGCCTGGTGGATCACCCTTGTGTGCCACTACCTGGTGAGTGGATGCTGAGGATCAT
GGAGACTCTGCGAGGGACCTGGGTGTCAGGGAGGGTCACACAATGGGAGCCTGAGGAGTA
GGGCCATGGAGACACAGGAAGGCAGCATTTGGCTATGCTCCGGAGTGGGCTGTGCCCATT
TGGGCTCTGAGGTCCAGAACTCCTTGCCTTAATACTTGGCCTGGTTCAGGGGCCAACTGA
GGCATTGCAGTTCTTTCTGAATGAGGGGTCACATTGGGTCAGTGCCCCACTTGTCCTAGG
TGTGGTGCAGTGGCTCTGAGTTGCTTTGCTGGTTTGTCTGGAAGTTTGCAGATGCTGTGG
ATCAAGTCTCTGTTGGGTGCGTCGGGGAGGGGGCTCAGATTCCAGAGGAGGCCTTCGCTG
AGGACCACAGCAAGGCAGGGAAGGTTCTGAAAGGGCCTTACAGCCTGAGAGTATCACATG
AGTCACTAGTCCAGTGGAGCCATGACCCAGGATCCTCCAGCCAGTGCCTGTTCAGATGAT
GCCAAAACCCGGACCAGGGAACCTGCGTAGTAGTGTCAGAGAAGCCCCATTCCCACCTCT
TGTCTCATCCAGGGGCTGGCCTGCTTTGGTGGGGCCCCATGGGTGGGCTTCAGACTGAAT
TGAGACCAGCAAGGGTGCCAAGGCTCCTCCTGGGCCTAGAATCTGTTTCTTCCAAGGGCA
GCACAAAGGCCACACAGGAGGAGAGGGCCATGGTATAGTCTGATTCCAGTACCCTATCTT
TGGGATGTGTATAGGACTTCACTGGGCAGTGACCATATGAAGAACGTGTTTCTGGGGGAA
TGGCCTGAGTTCCAGGGATCCAATGTGTGCATACCACCTGCACCTAAGCACCCGCTCCTG
TATGACAATCCTTTTTTTAAGGCACAGGGCACTACCTGGGCCTCTTAGGATATGACTGTA
CAACTGTTCCTCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAAGCAGTGTACCCTAGCCTGGCCATACAATCTGATCATACCTGCCTCCACCATG
ACCCACAGGTGATGTCAGCAGAGGAAGCCACAAGGGGACCAGTCCTAGGGGCAAGGGCTG
TGATCAAGGCCCCCATGGCTCATGAACTAGTGGTGCCAGCCCTGCTGGTAAAGAAAAAAT
TCCATGAGTCCCAGTGGTAAGCCAATTCATTAGGAACCTGGAGGTGGGATAGCATCAGGG
ACTTCCAGTGGTGTGGTTCCTCTGTTGGGTTGATGATGAGACCTCATACTTGTGGGGAGC
AACCCGGACTTAGACTAAGTTACTGGAATTAAGACTTATTCTATGCATCTGCTCTCCCAC
AATATGGCGCTGGGAGAGGAGGAAACAGCTTCTACACAGCTGCCTCCAGTTCAGCCAATA
AACTGTAGGACTTGCTCCTGATTGGAGAGCAGCGTACTCGGCGTGTGGGCAGCCGAGTTG
GGATTGGCGGAGGAGGACTATAAAGGAGGAGAGAGACGGCATGCACCAGGAACATCTAAG
GGGAACATCTAAGGGAACACCTGTGCAGCCCCCGAGAGAGCCGGCCGGCGGTGTGCCGCT
CCCCTGCGGAAGTGGGGAATGTGGCTAGGGGGAACTGCCCTTCCACAGAGGTGGAAGGGA
TAGTAGCCAACCCGGGAAGAACCAGCAGCAAGCCCGGGGAGGGCCGAGCAGACAGAAAGA
ACAGCGCAGGGTCCTGTGTCGTTCCTCCACGAAGAGGGGGAGCGACAATACTGTCTTGAA
GAGAGATGATGCCTTAAAAATAATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGAAAG
AGTAGTACAAGAGGACCTTGGTATAACAAGGTGCCATTCAGGGGAACCCTAGGGACTGGA
AGCCTTCAGGCCCTCTAGACCAGGATGTGGTTCCCAGGCAAGACCAACTACTTCTGTATG
GTTTGCACAGGCTCTTTCCTCCTCGTGCTTGGTGTGTGTTCCCCACTTTCTGAGATGCAG
AACTGTCGTAGTAGCCACTTCTTAGTCTCATTGGTCCCCTTCTGTCTTTCCGTGAGATGA
GCTGCCTGATCGAGCAACCTTGGACCAGGGTTCTTTGTGAGTGGATGGAGGGTATCACTG
GGCCTGTGTGGGGCAGCAGGGGTTCTGGGCGGATCACCCCACAGGAGCCTAAGTGGTGGA
CCCATGGAGACCCAGAAAGGCAGCCTCAACCCATGCTCCTGAGTGATCTTTGCCTTTTTG
GCCTTTGGGGTGCATATCAATTTGTCTGAACCTCTGGCCTGTTTCAGGACCAAGAGAGCA
ATGGAAACAGATTCTAGGGGAGGGGCCACATGAGACCAGTGCCATCATGTGGCCTTGGTG
GGCTGCAGCGGCTCTGGATTGCCTTGCTGGTGTGGGCAGAAGTAGGCGGACACTAGGGAT
CAGGACACTGAGTAAGGGTTGGGCTGAGATTCACTAATAGACCCAAGCCAAGGACCACCC
TGAGGCAGTGAGGGAGGTTTGATGGGGTAGCTAGCTTCATAGGTGCTGGGCAGTCAGGGA
GCTTTATGTAGGTCTTGGGGCTGCTGAAGCCTAGACATAGGAAATCTCAGCCTGGTGCCC
AGTAAATGGGCTGCTAACACATGGGATATAGAACCTACAGAGTGGTGCCAGGCACGCCCC
ATCCCTGTCATTTGCCTCATCCAGGGGCTGGCATTCACAGGCCATGTGGATGAGCTATGG
ACTCAATTGAGCCCAGCAAGGATGCTAGGGACCTTCCAGGCCCTGGGGTCTGACTCCTCC
ATGGGAGGCATCATACCGCCATGAAAGAGGGGGCGATGGTCCAGCCCTGTGCTGGTACCC
CAACTTTGTGATATGTACAATAGTGAGGTAGGCAGTGACCATTGGAGGAATGTGTTTCCA
GGGTGCACAACTTCAGTTCCCGGGATTCAGCTTGCCCTTGAACATTGAGCCTTTACGGGG
ATGCCATGTTGGTAGGCCCAGGATGTGGCAGCCTCCTTGTGAATGTCTTGTGGGACCACA
GCTCTGATGCTTAGTCCAGGCCCTTGCTTACTTATCCAGTCCAATTCCCAGTCAGGACCT
GGGTCTTGGGGGCAGGAAGAGGTAGTAGGTACAATGCTTCTGGGAGGATGATCCTGCTCA
AGTGGCACTCTCTATCCAGGAGTCCAAGAGTCCCTGCTGTTTGTGGGTGAGGTGGGTGGA
ACCTGCCCAACCCCACCACACCTACAGGGCTGGGTGTCTGGGAAGCCTCACCTTGGCTTA
AGGGGCCAAAGCAAGCTCTGAGACTACTTATCCTAGTTTGCTCCTGCTGTCTGTTCACAC
CTGTCCTCCTCTCTGTATCACAGATGATGTCACCAAAGAAACCCCCTTGAGGTCTAGTGC
CCCAGGTGCAAGGGCTGTGGTCAAGACCCCAGCAGCACATGAGCATGTGGTGCCAGCCCT
GGTGACAGAGGAAAAATTTGATACCACCTGTGGTAAGCCAGTCCATCTGGGCCCTGGAGG
TGGGGTGGCACCAAGATGTTACTGATGTCTAGTTCCAGGGGTTGAATCAATGATGAGACC
TCAAATTTTCTCAGACATGATGATGACTTAAAAATAAAGCTCAGTAGGATTACATTGAGT
CCCAGCTAGTGACAGTGTTTCAATAGGACCTTGAGGTAACCAGGTGCCTTCCAGGGGAGA
TGACCCTGGGGAGTGAAGACCTTGAGTCCCCCCAGGCCAGAATGCAGTCCCCAGGCAGGA
GATGCATCTCATGCAGGATGCACCCAAGCTCCATCTTCCTAGGGCTTGGTTTGTTTTCCC
TATTGGCTGAGTTGCAGGGCTACAATGGGAGCTCCTTCCTCAGCTTCTTTCGTCCCTTCT
GTCATTCGGTGAGTCAAGCTGTTCCGCAGTGCACCCTTGTGCCCCAGTGTCACAGGTGAT
TGGATGACAAGAATCATGGGGCCTGTGCTGGGGAACAGGGTATCTGGGTGGATGTACTGA
TGTGAGTCTGAGGGTTGGACCCATGGAGACACAGGAAGGCTGCCTCACACAGCACTCCTG
AGCTGCGCAGCACTGGGATCTGCGTGTCCAGAATGTCTTTCCTGATCCCCTGGCCTAAAT
TAAAGGCCAAGCAAGGAATAGGAACAGTTCCTGGGAGAGGGTTCATGTGAGGCCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGGTTTCTCTGGCTAATAAAGGTG
CAAGGGTTGGCAAGATGTGGACGATAGCACCTATACAGTGGTACTCAGCATGCCACATAC
CTACCACCTGCCTCGTCCAGGGGCTGGGTTTTCCTTGCCACAGGTATGTTCTTCGGAATG
AGCTGAGCCCAGCAAGGATGCCAAGGACCCTCCTGGGACAGGCTTCTGCCACTCAGTGGA
AAGCATAAGGCTCCGCAGGAGGAGTAGGCCATGCCCCAGCCCCATGCCCATACATCTTTG
TGATGTGTATGGTACTGACATGGGCAGTGAATATAGGAGGGAGGTATCACCTCAGGGCCC
CAGCCTGAGCTCCCAGGGTCCACCGTGTTCACTCACCATGCACATGATCTCTTGGGCCTG
TATAGCAACACCATGTTGGTATGATCAGTACCACATGATGGCCTCTTTGGGGATATCTCA
TGGGACTGGAACTCTGATGCTTAGGCAGGCCAGTGCTTGCTTGTCTATCCCAGTTTCCAG
TCCGGACTTGGGTGTCAAGGGCAGGAAGGGGTGGTGGGGGTATGTGCTTCTGGAAAAACA
ATCTTGCCTGTGTGGGCCTCTTTGTCCTATGATCCAAGAGTCCAAACTATTTGTGGGTGA
CATGGGTGGGGACTACCTGACTACCATGCATACAGGAGTGGGCTGCCGGGAAGCTTTACC
TGGGCTGATAGGGCCATGCACTGGAACCAGTGTAGTTTGCCCGTGCTATCTGTTTCTACC
AAACTCACTCCCTGTCCCACAGATGACGTCAGCAGAGGAAGCCCCAGAGGGGTCAGTAGC
CTGTTGATAAGTTCTGTGGTCAAGACCCCAGCTATCCATGAGCTGGTGCCCTGTTGGAAA
AGGATACCCAAGAAACTGCCCAAGGTAACCCAGTCCATGAGGGTCTTTGTGTGGGATGAT
GCCAGTGGGATCCTATGATGTGGTTCCTGGGATTGGGTCAATGATGAGACCTCAATTATC
TCGAAGAGAGATGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTG
GTGATGGTAATGCACGAGGACACCAAGGTCTCCATGTGTCTTCCAGGACTGGAGACCTGG
AAGCATCCAGGCCAGTACACAGTCCCTGGGCAGCAGCTGCTGCTCCTGCAGGATCCACCT
AAGCTTCTGCCTCCTTGGTGCTGGGGTGTGCTCCCTGCAGTACGAGTTGCAGGGTTGCAT
TATGGGCTCCTTCTTCAGCTCCTTTCATCCCTTTGTGTCTTTCAGTGAGATGTGCTACCC
GGTATTTCACTCTTGGATCCCTGGTCCCAGGTGAGTGGATGACAGCTATCATCAGGCCTC
TGCTTGGGAGCTGAATGTCAGGGTATGTCACCTACCATAAGCCTGAGGAGTGTACCCACA
GACACAGGAAGGCTGCATCAGTCTGTGCTCCTGAGTGTGCTGTGCCCTTTTGGACTCTGA
GATCCGGAAATCCTTGCCTGAACTCCTGGCCTAGTTCAAGGGCCAACTGAGGGATGGCAA
TGGTTATTTGGGGGGGGGGTGGGTTCCACATGGAGCCACTGCCTCCACTCAGTATAGGTA
GGCTGCTGCAGCTATGGATTGCCTTAGTGTTTTGGCCATAAGTGGGTAGACACTGGGTAT
CAGTTCCCTATGTAGAGATAGTTCTCAGACTTTTTAGGAATCCCAGGATGAGGACAAAAC
CAAGGCAGTGAGAGAGATTTGACAGGGCACCCACCTCTGCAGATGCCTAGCTGCCTGGGA
ATTTCATGTGGGTCACAGGCCACAGAACCCTATGAAGCAAGGTACCAACACAAGGCCCAG
AGCACCTGCAGGGTGTTGCCAGACATGCTGCATCCCACCACTGGCTGCTTCCATGGGCTG
GCCTTCCCAAGCCACATGGGTGGACTACAGACTGAGTAGAGCCAAGCAAGGATGCCAAGG
TACCTCCTGTTCCCAAGCTTTCACTCCTCCTTGGAGGCACCAGGCCACACAAGAGGAGAG
GCATTGTCAAGCACAATGCCCATACCCCATCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved