Oryctolagus_cuniculus Locus Mono:62:SNORA7
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:62:SNORA7
Oryctolagus_cuniculus
Mono:62:SNORA7
scaffold_98089
SNORA7
1001..1143
2143
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCAAGACCCC
TGAGTCACCCATTCACCGAAAATCCTCTAGACACGGAGAGTAGATCTAAATCTATGACCC
GAACACATGAAATCATCCAGGCACATCGGACATTCCAGACACGAGAAATGTTCCAGACAC
AAGATGTCTTCCAAACTTGAGAGCAGGATTAGCAGTGACACACACATTACAGGTACGAGA
TGACGGCTAACCCAGCAGGGTTATTTCTGATATGGAACAGGTTCCTTAGACATGTGGCCC
TCAAGACTATTCCATGGTTGCTATCTTTGAATTGATAAGATGTGGCCCGGGCAGTAATGT
GGTTTCCAGATATATGAAGAAGTGGGTGGCACCCCCTGGTTTCCAGTGGTCGTCTCCTTA
CCACGAAGTGCCCATCAATGATCTCCGGTCACTCATGCCAGCCTCTGCTAGGATCACTCT
GTGGTCTTGAGAGTGGACTGTCTCTGTCAGCTTTGGGCACAGAAGGGAAGCAAGGCTGCA
GAGGCACCTGTTCCATTCCTGGCTTGCTCAGTAGGTGGCGACTGGAAGACACTCTGCAAC
TCGGTCTGCCCTGAGTCTGGGCACACATGAGCGCTGTCTGCCTCAGTCTGAGCTGACTCT
GGGCACACATGAGCTCTGTCTGCCTCAGTCTGAGCTGACTCTGGGCACACATGAGCTGTG
TCTGTCCTTGGTCTGAGCTGAGTCACACACATGAGCCCTGTCTGTCCTTGGTCTGAGCTG
AGTCACACACATGAGCCCTGTCTGTCCTTGGTCTGAGCTGAGTCACACATGTGAGCCCTG
TCTGTCCTTGGTCTGAGCTGAGTCACACACATGAGCCCTGTCTGTCCTTGGTCTGAGCTG
AGTCACACATGTGAGCCCTGCCTGTCCTTGGTCTGAGTTGAGTCTGGACACACGTGAGCC
CTGTCTGTCCTTGGTCTGAGCTGAGTCACACACATGAGCCCTGTCTGTCCTTGGTCTGAG
CTGAGTCACACATGTGAGCCCTGTCTGTCCTTGGTCTGAGCTGAGTCACACACGTGAGCC
CTGCCTGTCCTTGGTCTGAGTTGAGTCTGGGCACACGTGAGCCCTGTCTGTCCTTGGTCT
GAGCTGAGTCACACACATGAGCCCTGTCTGTCCTTGGTCTGAGTTGAGTCTGGGCACACG
TGAGCCATGTCTGCCCTTGGTCTGAGCTGAGTCTGGGCACATGTGAGCCCTGTCTGTCCT
CGGTCTGACCCGTCTGGGCACAGGTGAGCCGTGTCTGTCCTCGGTCTGACCTGTCAAGGC
ACACGTGAGCCATGTCTGTCCTTGGTTGGAACTGAGTCACACACGTGAGCCCTGTCTGCC
CTTGGTCTGAGCTGAGTCTGGGCATAGGTGAGCCCTGTCTGTCCTCGGTCTGACCTGTCT
GGGCACACGTGAGCCATGTCTGTCCTCGGTCTCACCTCTATCTGGGTACAGGTGACCTGT
GACTCTCCAGCCAGCCTCTGGTTATTTTGGTTGACAGCTCTTTATAGACATCACTTTTAC
CCCCTCTGAAATCAGAGCGACAGCAACCATGCCAGTGGACTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved