Oryctolagus_cuniculus Locus Mono:187:SNORA71
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:187:SNORA71
Oryctolagus_cuniculus
Mono:187:SNORA71
GeneScaffold_1121
SNORA71
1001..1133
1914
CGCGCCGTCCCTGCCGAACCCTGGAGCTTTCGCACACCTCCGCCTTCTCAGCACCTTCT
GGATACCTCCTGGCAGCTGGCGGCTGGCCTGTGAGTGCGCCCTGTGCGCGGCTCCCTGCT
GGGCCTGTGTGAGGAGGGTGTGTTTGGGTCCCTGTTTCAGGCAATGTGTGAGTTGGTAGC
AGAGCCCCAGCTGGGGCCTTGTGTTTTGGTTCCCTTCTGGGTACTGGTCATTCACTTTGG
CAATTGTTGGGTTTGTTTTTCTCTACAGCACCTTGAAGGTGGTGTCTAGCTTACTTCTGG
CAGACGGCAGTGCGCAGCACTTAAAGCAGGGGTGAAAGCAGAAGCTGGAAAGAACAGAGG
TGCAGCTGTAAGGTCAGTGGGTACATGGAGGGGGGTGCAGTCCTGGGCTGCCTTCCCAGG
TGCCATAGCAGGGAGCTGGACCAGAAGTGGAGCAGCCAGGACTTGAACTTGTGGAACTTG
TGTTCCAATGTGGCATGCCAGCCTGCCAGCTCACAGGTGCTCAGTCTTTTTGCTGGTGAA
CCTGGCGAACAACTGCAGAAAGACTGAGCACCCGTGAGCTGGCACTGTGGTGCAGTGGGC
TAAGCCACCACTACGGCAACAGCTTGGCCTGAATCCCAGCTGCTCCACTTGCAGTACAGC
TCCCTGCTATGAACCTGGCTTGCCTTCCCCTTCTAACGGGGAGTGGGTGCATGAGCTCTG
CGTGGTTTCACAGGCTGCTTCTGTGGGCCCTCCTTGGCCTCCCCCTTTGGCTTTTTTCTA
CTCCTGGTATTCGAAAGTGATCGTGGGCTGCCCGTGCCCTGGTCATTGATAGTGCAGGGA
GAGCAGCTGCTGAAAGCGCTTCCCCGTGTTTGGAGGGTCCGCGCCGTCCCTGCCGAACCC
TGGAGCTGTCGCACACTTCTGGCTTTGTGACCCTGGTGCTCCGTTCTGCCCGGCTTGTTG
AGTATTGAGTGCTGCTTCTGCCCGGGTGGCTGCAAGGCCTGCCTCAGGGTCCCTGTCACT
GCCCTTGACTGGGAGCCACCTTGGGGATCCTCCTCCCAGGGCTTCCTGCTGGAAGCTGTC
TGCTTCCCTGTCACTCTCTTCTCCACATTCTCAGCCTGGTCTCACCTGGTGGGAGTGGCT
GCTCGGCGTGGCCCTGTGCTGGGAGCTGTCTGAGGGCAGCACCTCTGTCTTGCTTCACAG
CATCCCTTGTGCCTGACCTGTAGCACCTGGGCCAAAAGAAAATGAGCAGACGTCTCACTG
GGAGGCGGTAGGGCTTGTTGCTTAGAGCAAGCCAGCCATCAGGCCTGAGGCATTTGCTTC
CTTTCCCTCTCCGATTTCTCTGGGGGCCCAGGCTTATTGTAGTTGACTTTTAGCTGTGGC
CATGAGAGAGACTCGCTCCTCTGGCTAGGGGGTAGTTCTCTGGCCTAGGTTAAGGGGGCC
GGAACTAGTGTAATCACTGGGGCGGGCAAAGTACAACACAGTAGGATTGGGTATGTGGAT
GTCGCCCTTCCACACTAGATGGTGGGAGTGGGACCCGCCACCACCCAGTACCCACCCAGG
CCTGCACTGGTTGCACCCACACACGGCTCTCCCCAGACTTCCTGGCCTCAGCAGTCATTT
CTGAGTATATATTGTTGGAGGTTGACAGCGTGATGTTACTTGGGATACATATGGATAGTA
AAATGGCTGCTAGAGTGGAGTGGAGTAACATCCTCTCACATGTTTCTCTTGTGTGTGGGA
GACACGAGCAGCTCAAACAGATGTCTGTAACAGAATCCCGAGTCTGGTTTTCCCAGAGCG
CCCTTATTGTATGTTAGCCCTGTCAGCCACTTCCTGTCCCCACTTCCTTTTCTCTTTATC
CCCATAGTAACCACTGCTTTATTCTTGCTGATGCTGAAAATTCAAAAAAAATCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved