Oryctolagus_cuniculus Locus Mono:34:SNORA58
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:34:SNORA58
Oryctolagus_cuniculus
Mono:34:SNORA58
scaffold_187788
SNORA58
1001..1136
2136
TGCCCAAGTTTGCTTTGATAGCTCTCACTCAGCAGGGTTTACCATCATAGCCTATGAAA
GGGGATGTTTATTTTCTTCCAAATGTCATCATATGCCTTAGCCCCATATGGCAGCAAGAA
AGAAATCTGACTAGAAACTATGGACAGACTGCATACTTGGATGGATGACTGCAACAGAAC
AAAAGGAGGGGCTGAGAGGAGACAGCCCTGCTTTTCCATTCTAGGTAAAAACCTAGACAG
CCCTCTGGAGAGATAAGCCCAAACAAACCCATCTTTCAAAGCACCATTTAAAAAAAAAGA
TGCATTGTAAGAGCTATTCATATCATATTTAAATTTTTTTGCCTGATTCCCTCCCGGGGT
TCATTCTCATCCATTAAATATTCATTTCCAGGGCTTTGGGGCAGCAAGAAACAAAAACAC
AGCTGCATTAAAATGTTGTCACACTCGGGAGAAAACAAAGCATCGTCATCCACGAGCACA
CGGCCCCATCCACCATATAATCTCTCAATTTCCTTTTACTTCCACTGATGAAAAGCAAAG
TGACACTTTATTCCCCCTTTGTCACACAGAGTAAGAAAGTGTGAGACATGCCTACTTCCT
TTGTGACCTATTATCAGGCTCCTTTCAGGATTCTTTGCAATCACCTAGCCTGTAAGGAAC
TACATTAGTTTTCATGAAAGGTAAGTGGAGTTTTTCTTTCAGTTGATTGAACATTTGCTC
AGAAGCATCCAAGATTTCTAATTCCTGCTCTTATGGACTTGTTATTCTACGTTTAATTGG
ATAGTATTTCAGGATTCTGCAATGCCTATGTTGGTATGGTGTTATGAGTTTAAACAGGGA
AAGAGTGTAAACATAGTCAATTGAAAATTCTACAAATATGGGCCCAGCTGAGGCTTGTTA
CTGCGACAAGGATGAAGAAAGGTGGAAAAACAGTACCAACTGGGTGGAAATTCCACCACA
TCCAGGAATGCAAGAAGTAGCTTAAGAAGAGAGAAAACTCCAGGCATACCCATAGACTTT
GCCTGAATGTGCTCATGGCCAGACAAGGGGGACTGTATACCAAGAGTAAATTTAGAGTTT
GTGCCAGCTGTAGCCAGCTAAATACATGGCTATATAAATTGCCACACTTCAACATCATAA
AAAAGAGAGAAAATTCCAAAAGATCTTGGACATATTTCTAGATTTCTCTCAAATTTTATT
TTTAGTGATTAGCATAGAAGTCTTATCTGTAGATGTACTTTCAATTCCTCTGTATAGAAG
ATGTTATTATGTTTCCTGGTAGAGATTTTGTTTATTAGAGCTAGTGCTTTATTCTTTTTA
TTAAAAGATACATGGTACAAAACAAAATTCGCATCCACTGTTGTTGGAAATATGGTCAGG
CTAATGTCCCAGCTCCTCAGAAAAATATGTGAAACAAATGGTAATGCCTATGTTTGTCCA
AAAGATAGAAAGTATACCAAGTGCATCTTAGTGGACTATTTTGTAAACAAAGTAAAATGA
TTCTGGTGACACATAAAATATACTCCTCTTCATATTTACTTTTTTGAAGGTTAAAATTCT
AACTAAAACAGCTCACTTACCCCATTATAACCATCTTATGGGTAAATGCTCAACAGATAA
AATAAAACATCTGAAAGTTCTTGGGGAGGCCAGCATTGTGATATAGCAAGTTAATCCACT
GCTTGCATGCCAGCATCCCATATTGGAGGGCTGGGTCAAGTCCCAGCTCTTCCACTACCA
ATCCAGATTCCTGCTAATGCACATCTCTAACAGTCACCATGTGAGAAATGAAGTACTTGG
GTCCCTGTCACTCACATGGAAGACTTAAATGGTGTTCCTGGCTTCTGGCCTTAACTGCCC
CCAACCCTTGCTGATGCAGCCATTTGGACATGACCCAGCAGATGGAAGATGGATGTCTCT
TTTTCTCTCTCTCTGCCTTTCAAATAGAAAACATTATCTTTTAAAAAGAATTTATGGAAA
AATGGACTTAAAATAGTGGTTCATTTGGGTATAAAAAATTAGAAATCCATGCATGGTTTT
TTCATAATATGCATTTTCCATGAATTTATTGAAGACCTCGCATATTTGCTGAGTTATCTT
GAGCTGAATTAATTATAATTCCAAGGAAAAGTGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved