Oryctolagus_cuniculus Locus Mono:49:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:49:SNORA51
Oryctolagus_cuniculus
Mono:49:SNORA51
scaffold_172600
SNORA51
1001..1119
2119
GAAGGAGAAGCACCTGGCTCCTGCCTTCGGATCAGCGCGGTGCGCCAGCTGCAGCGCGC
TGGCCGCTGTGGCCATTGGAGGGTGAATCAACGGCAAAGGAAGACCGTTCTCTCTGTCTC
TCTCTCTCACTGTCCACTCTGCCTGTCAAAAAAATAAAAATAAAAAAATAAATAAAAACC
CACATATATCAATAACTTCAATCATAAAAGCAGAAAGGAGCTCACAATATAAAATAGATT
GCTAATGCTGTAAGTAAAAGTAAATAACTTTAGTAGGAGTTACCAGGAAATCACTAGAAG
ATATAAAGGGAGTTTGGTGAAAAAGAATCCATTTCAATCAGGTTTAAAATTTATTTGTAA
ATAGCGTCTTAAATCATGAAGAGATCATTCTACTTACACTATATTATAAGAAAGTTGCCA
GTGTTTAGAAATGCATAATGGAAATAAATTTTTAAAAAATAACAATTTAAAAAAGAAAAA
AACAACAACAATAACAAAAATTAAATGCATAATGGAAAATTTCACACATCAATGGCTAAA
TTCCAGAAAGATAAAAAATGATATGTGGAATCGAGTACACCATGGCAAGCACTCTGAAAA
ATTGTAGACATGAAACTTTCCAGAATTTATAGAACTTTGAGCAAGTTTGTGATACCACAA
TGAAAATGCAAACCAAGATTGCCACAGCTCATATGATCACCATTGGCTTACTATGAAGTT
TGTGAACAATACAGGGTATAACAATAGATGCAAAGGCAATGAAAAGAAATGTACATGTTA
TGGAATAATGTATGTTGTGATTACTCCACCAAGAAATGAATAATAATGTTGTGAAAAGCA
GATAGAGAACTTTCTGTTGTACTTCATTGCAATTACATCTATATTGGAGAATATGAAAAA
AATACCAAAAACACAATTGAAAAAAGATTATGCCTTGTTCTACCATATACGAAGGCACAG
ATTTCCATATCTAGATTATGCTTAGAGACACATTAAAAATTAGCCTCCTGGTGCTTACCA
CAATCTGTTCTTACACTGACTGTATAGAAAGAGGAGGCAGATGCAGGCTCTCCCTCAGGG
CTCATCTTGCCTGGGCTGTATTGTGAATGGGGGGACAAGGAGTTGAGGGGACTGGCATCT
GGCTTGTCCCTGTTTCCTCCAGGCTGAGTGGGGGCCACGAGGGCTGAAGTAGGTGCTTTG
TGGCTTTGCAGCAGCCGAGCCAGGGCAGGGCGGGACTGCATCTCTGCAGGGAGTGGTATG
GTTATCACTTCCCGGAGGTGGTGAAGATCATCAATGACAAGGCCACATAATGCTGCCTCG
CCCAGTTCATCAGAAACCAAAAGGAGTTGAATGAGGACAAGTTGGAAAAGCTGGAGGAGC
TAACAATGGATGGTGCCAAGGCCAAGGCCATTCTGAATGCCTCACGGTCCTCCATGGGCA
TGGACTCTCTTCCATTGACTTGATCAACATCGAGAGCTTCTCCAGCCACATGGTGTCGTT
GTCTGAGTACCACCAGCTCCAGCTCCTACACACTTACCTGCACTCCAAGATGAGCCAGGT
GGCCCCCAGTCTGTCAGCTCTCACTGGGGAAGCGAGCCCTGAAGACACGGGGTAACACAC
CAAAATACGGACTTATTTTCCACCCCTCCTTCATTGGCTGAGCCGCCTTGAAGGACAAAG
GCTGCATCTCCTGATACCTGGCCAACAAATGCAGTATTGCTTCACAAATAGATTGCTTCT
CTGAGGTACCCACAAGTGTATTTGGGGAGAAGCTTCTCGAACAAATTGAGAAGCAGCTGT
CCTTCTATGAGACTGGGGAGATTCCACGGAAGAATCTGGATGTCATGAAGGAAGCCATGG
ATCAGGCAGAGGCGGCGGCTGTGGAGGAAGCTGGAGAAGCAGCAGAAGAAATGCTTGAAG
AAGGAAAAGAAGGCCCTGGTGGCGCTCACCCTGGCATCTTCAGAGAACAGCAGCAGCACC
CCGGAGAAGTGCGAGGAGGCGCAGGAGAAACCCAGAAAGAAGAAAAAGCAAAAGCCCAGG
AGGCTTCTCAGGAGAATGGGATAGAAGAGCCGTCTGTCTCTTCCTCCAACCCCAAGAAAA
AGATATATTTTTCCAAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved