Oryctolagus_cuniculus Locus Mono:196:SNORA61
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:196:SNORA61
Oryctolagus_cuniculus
Mono:196:SNORA61
GeneScaffold_6293
SNORA61
1001..1135
2135
AGTGCCAAACTGTTAAGTCAACAACAGGAGTCACTGTGTACTTACTCCTCATGTGGGAT
CTCTGTCCTTAATGTGTTGTCCAATGTGAAGTAATGCTATAACTAGTACTCAAACAGTAT
TTTATACTTTATGTTCTGTGTGGGTGTAAACTGATGAAATCTTTACTAAATATATACTAA
ATTGATCTTCTGTATATAAAGATAATTGAAAATGAATCTTGATGTGAATGGAATGGGAGA
GGGAGCGGGAGATGGGAGGGGTGCTGGTGGGAGGGAAGTTATGGGGGGGAAAAGCCATTG
TAATCCATAAGCTGTACTTTGGAAATTTATATTTACTAAATAAAAGTTCAAATACAAAAA
ATGCCCTCCAGAAACCCCCAGTACACTTAAGACAAAGACCCCACACTTTAACAGAGCCCT
ATAGGGGTGATCCTGCCACGTTCACTGGTTTCGTTGCAAACTGTGCCCCTCTCCCTCTAC
TCCCTGGAGTCCTCCCAGTGTGCTCCTCAGTTCCTGAGCCCCTGCCCATCTGCAACAGCT
CGTCACTTCTTCAGGGAAGGCTCTCCTACCTTGAAGGACAGATACTTACTTTACTTACTT
ATATTTACTAATAAACCCACTCAAAGATCTGAGAATCACACACTGGTGTCCATGACATTC
CTACTTCATGAGGACCACCCTCTCCCCCTTGCCTGGGTCCTGTTCTGTCCCTGGATGCTC
CCTCTCCCCACCTCCCTCACCTCTTAGAAGGAATGGGAAAAGCTGGAGGAAACTTTACCT
GCTTTCATGTCCTTGCAGCTGCAGTGGCTGAGGAGGAGCTGGCTGGGCGACGGGACTGTT
GGGGGTGGCTGGGCTTGGCTGGGCCGAGGGGCTGTGCTGCTGGGCCGAGGGGCTCTGCTT
CTCTGAGCTGGGTGCCGAGGCCGGGCTGTTGAGCTCTGCGATGGGGGAACCAAAGTGGCG
CATGCAGTCACTAGGGCTGGTACTGGATAAGAGGTGACCCGACTCTCCAGTTCTCCTTTC
TCATTGGATTGGAACACTGGTCTTGGTGGTTGTACTAGGGAGGAAAAGTGATACTGAAGC
TGGCTTCATGGTGTTGTAGTTCTGATATACAGCATTGGGGTCAATTTTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNACAAGTCTCTTGTTTGGTCAGAAGAAAAGATCACACAGAAAATCT
ATTTAACACATGAAAAAAATCATCTGGGGAGAAGGTCTGAAATATATGTGTATTCTATCT
TCCTCACACTGCTTGCAGAGAGAAAAAGGTTTAGCTATTATTATTTTTTTGGTTGAAATG
AGAATTCTTAAGTCTTTCAAAATGTGGGTGAGGAACTAACCCTAAAATAGGAAATGCTTT
CTGCAATCTCTCTCTGCAGTCCCTGTCAGTCTTATTGTCAAATAGCCAGCCCTTTTTACC
CCACAGTTCTCCAGAAACAAACAAACCAAAAAGGCCACTGGACTCAGGAAAGTTCATAAA
GCTGTTCTCAACAAACACGTTTCAGACCGGGAAAGCTGAGACGCATGTCAGATTTCTAGT
GAACGATCTTGCTTACACGTAATTTCCACTGAGTATTTTATACACACTGATGTCTGTGGA
TAACAGGTTAAAAAACCCAAGGTCATTTTCATTGGGGGTTGGGGGATTGGGTGATTTATT
AGTGTTCCATTAGAGGCCATTCCTCTCTTCTTTTCTCATAGAACAAATTAAAAAAAATTC
CCCCCATTTATATCAGTGTCTCCCAACCTTGGCACTATTGACATTTTGTGCCAGCTCATT
TGTGCCAGGGGAATGGTTTTGTGCACTAGAGGAAGTGTATAGCAGGATACTTGGCCTCTA
ACAACTAGATGCCAGTAGCATGCCCATCCCAATCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved