Oryctolagus_cuniculus Locus Mono:197:SNORA21
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:197:SNORA21
Oryctolagus_cuniculus
Mono:197:SNORA21
GeneScaffold_760
SNORA21
1001..1125
2125
TTGCAATGCCAGCATCCCAAATAGGAGCGCTGGTTTGAGCCACAGCTCTGTGCTTCTGA
TTCAGTGCCCTGCCAAAGTGCCTGGAGAAGCATCAGAAAATGGCCTGAGTAACTGCACCC
TTGCACACGGGAGTCACAGATGAACTTGCAGGCTCCCAGCTTCAGTCTAACCTAGACCGA
GCTGTTGCGGCCATTTGGAGAGTCAGTGGGTGGAAGGCCTCTTTCTGTCTCTCCTTCTCT
CTCTCTGGTTTCAAATAAACAAAGAAAAACTTAAAAAAAAAATAAAGCACAAACCACAAA
GAACCATCAGATAAACTAGACTTCAACAAATTAAATTGTAAATTGGAACACTATATGAAA
GGACATTATCAAGAAAGTGAAAACAGCCAACAGGTGGGAGAAATATTCTGCAAATATCTG
ATAAAAGGCGAATAAGCTAATTTCTAAAATGGGTGAACAATATAAATACTTGCTCCAAGG
AAGTTGCGAAAATGGTTAATTAGGCACATGAAAAGATGTCCAACATCATTAGGTAAGACA
AACCTGCAAGGAAACAGCTTACATTCAGACAGCTATAACAAAGAGAGAGAGAGGAAAACA
AGAAATAATAAATGGAAAGTAAGTTGGCAAGGATGTAGAGAAACTCAAATTCCCACACAC
TGTGGTTTTTCTTTTTTAAAAGATTTTATTTATTTATTTGAGAGGTAAAGTTACAAAGAG
GGAGAGACAGAGAAAAGGTCTTCCATCTGCTGGTTCACTCCTCAAATGGCCGCAAGGGCA
GGAGCTGGGCCCATCCAAAGCCAGGAGCCAGAAGCTTTTCTGGGTCTCCCACATGGGTGC
AGGGGCCCAAGCATGTGGGCCATCTTCTGCTTCTTTCCCATGACATAGCAGAGAGCCGAA
TTGGAATATGCCAGAGCACTGGCCCCTCCCATACAACTGTTGATTAGAAGGTTTAAAAAA
AAAAAAAAAAAAGTCCCTATTTAAAAAAAACAGCCAGGCTTGCCTTTTTAAAAGCATTCC
ATGGGCATCTACTAATGATCCATCAAGAAGGGGCAGAGGGAAAAAAACATTTTGGTGAAG
TGGCAGCATGTTGTGTTGTTGTGCTTCAATTAGTGCTGTTACACGATGTTCCCGAAAGAA
AGCTCGAGTGATGGGGGCTGGCACTGCAGCATAGGATAAGCCTCCACCTGTGTCACCAGC
ATCTCATATGGGTACCAGTTCATATCATGGCTGCTCCTCTTGGCTCTCTGCTAATGGTCT
GGGATGCAGTGGAAGATGGCCCAAGAGGTTGGGCCCTGCACCCACATGGGAGACCCAAAG
AAGCCCCTGGCTCCTGGCTTCCAATTGGCCCAACTCTGGTTGTTGTGGACATCTGGGGAG
TGAACAGTGGATGGAAGACCTTTCTCTCCGTCTCTCCCTCTCACTGTCTGTAACTCTACC
TCTCAAATAAATAAATGAAATCTTTTTTAAAAAATAGCTGAGCAACTCTTCAGAAAGTGA
ATCAGAGAATTATTTTCATCCAGTGTATGTACTCCTAGGATCATACCCAAAAGAACGAGT
ACTCAAATACTCAAGACTTAAATATACAGTACTATTCATATACTGCAAAGGGGGACACAA
CCCAAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTAAATCCAATAATGAAAAAATGATTACTAAGAAATTCTGTTAA
ACAAAAGAAATCATTAAGAAAGTGAAAAGCCAAGTTACAAAGTAGGAAAAATTTACAAAA
CATGCACAGTTTCTGAAATGCTCATGGAAAATGCATATTATGAAAGCTGTGCATGAATTT
CAAAGACCTTTTGGACCAAAATAAGCTTTTCATTTCACTTTCCATGAACTTTTTGAAGTT
CTCTTGAAAGAGACGGACAGACAACAGAAAAATATGGAAAAAGACTTGAGCAGGCACTTC
ACAAAGAAGGCATCCAAAACGTCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved