Oryctolagus_cuniculus Locus Poly:21:SNORD116
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:21:SNORD116
Oryctolagus_cuniculus
Poly:21:SNORD116
scaffold_181458
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1094, 3687..3780, 6355..6448, 7956..8049, 10648..10741, 13803..13896, 16459..16552
17552
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCTGAGAACCCACTAGGGCCTATTCAGGAGAAGCTTGTGTAGGCCTTGTCAATCATGGAC
AGACAGGTTCAATGACAGGAAGCCTCAGGGATGAAGATTGATGGGACGCGCTGTGGTGCT
TGACACCACAGCAGCCTAGCGTGGCAGCTTGGAACAGGCCAGGGATCAGGTTTCCTCAAG
TGTGCTTGTGGTTTGTGTATACGTCACAGGACGGCTCGCTGACGTTGATGTGGCCATGCA
GGGCGGGAAGAAGTGTGCTTCTGCTGAGAACTTGAGGCCCTACAAGACACTAGAATTCAA
ACTGCCCTTGGTGAGAAGGAAGTTCCTGGATCTCTGAGGACGGTAAGCATGGCCAAGACC
AGCACTGGGGACAAAGGCATAGCACTTGACAGCCCCACAGACACCTGTATGCTTGCTGGA
GACTTTGGCCACGCCTGGGCCACACCTCTGCAGTGGACCGTCTGTCCTCCTGCGCTGGGG
TGTATCCCTGGACTCTGGAGGGCTGCAGAGGTGGTTGGGCGGAGCAGCTGATGAAGCACC
AGGCCTTTGGTGTTGAGGGCCCCACCCATTGGCATGTGCTTGGATCGATGATGACTCCCC
CATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCATTCTCA
TCGTGACTGAGGTCCAGCACGTTGCCTCTGGCAGGGACTATGGCAGTGAGGGCCCACGAT
TAGGGTAGCAGTTCTCTCCACACCCAGGGTGTGCCTAAGATGAAAGGTCCATTCGTGTGG
CTCAGAAAGCATCACTCAGTTGTCCATATGGGCAGCAGAGTGCCTTGTGCAATGGTGCTG
TGAGTTTGCTTGGCAGCTATCCATGTGGGCAGCAGTGGTGAAGGATGTAGCAGGGTGTAC
AGGGTCTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCAGACTGTGTCTCAGGTCCTATGAGGCAGTGTGCCTCACAAAGTGGTCCTTT
CTTTCCCTGGAAGTTGCCACGAGTTTTGAGGATGCGCGTGGAAATTTTCACTCTGTGCCA
AATGTCAGTGCCCATCCACGGTATTAAAGGCTCAGACCCCCAGCAAAGCAGTGCCAGCAG
GTAGATGTCAAACCTGTCCAGAAAATGGTCACCGATGGCATGACCAAAACATACTAGGGA
CACAGACACATATATACCATCACTCACATCTTCCCAGAATTTAGAACTCAAGCTGATAAC
CCACAAAGGCCTACTCAGGAGAAACTTGTGTGCCCATAGTCCCATCATGGACAGACTGGC
TTGTGTGTAAGGAAGCTTCAGGAATGAAACTGAGGGGGGGTGCGATGGCACGGGTCACCA
CGGGCAGCCTAACCCTGGCTCGGCCAGGGATCTCATTTTCTCAAGTGTCCCTGTGGTTTT
GTGTGTACTTCTCAGGACCGCTTGCTGATGTCAGTGTGGCCGTGCAGGTGGGAAGAAATG
TGCTTCTGCTGAGAACTTGAGGCCCTACAAGACACTAGAATTCAAACTGCCCTTGTTGAG
TAGGAAGTTCCTGGATCTCTGAGGACGGTAAGCATGGCCAAGGTCAACCCTGGGGACAAA
GGTCATAGCTCTTAACAGCCCCGCAGACACCTGTATGCTCCCTGGAGACTTTGGCCACAC
TTCGGCCACACCTCTGCAGTGGACCATCTGTCCTCCTGGGCTGGGGTGTATCCCTGGACT
CTGGAGGGCTGCAGAGGTGGTTGGGCAGAGCAGCTGATGAAGCACCAGGCCTTTGGTGTT
GAGGGCCCCACCCATTGGCATGTGCTTGGATCGATGATGACTCCCCCATAAACATTCCTT
GGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCATCGTGACTGAGGTC
CAGCACGTTGCCTCTGTCAGGGACTATGGCAGTGAGGGCCCACGTCCAGGGTAGCAGTTC
CCTCCACAATCCAGGGGGTGCCCATGGTGAAAGATCCATTTGAGCGGCGCCAGCAAGGCG
ATCTCTCAGTTGGTAGCTCTGGGCAGCAGAGTGCCTTGTGCAATGGTGCTATGAGTTTGC
GTGGCGGCTCCCCACGTGGGCAGCAGTGGCGAAGGATGTAGCAGGGTGTACAGGGTCTGA
TTGTGTGGATGTGCCCAGGCCACTTATTTCCCACGAAGGTCTGCTGTGTGTGGCAAAGTC
CCTGGTCCCTGTGGGGTAGGCCTCAGAATCAAGTTTTCTCGTGTTGGCCAATTGGACCCA
CAAAGCCCGGTCCCCTGTCTAGCTTTAGGTCTATGAGCTGGTGGTCTGATGTGGCAGCAG
AGTTCTGCAATGGTCTGAAGAGATCAGACATCCCCTTGAGTGTGGCATTGACACTTGGCG
GTAGTGCCTGTGTGACCTGATGGTAGGAGTCAACCTGGCATGAAAGTTGTGTTCCTTTCT
CTTGAGAGAGTCTGAGAGTGGAGCAGCTGTTAGGCTGGGTGCAAAGGAAATGACAGGGAC
AGAGGGATTGTTTTGCTCAAGGACACCCTGGAGAGCATGGTTGCTATAAGTTCTTGAGGT
GCAGCAGCATGTGTTCCATGAATCACCCAGGGTGATCCCCAGTAATGTCATATTTTGATC
ATGCAGTGGAGCTTGGGCACACATAGGCTGCAGTTTTGAAGGTTCCTTTGTGGGAGGGAT
AACAGGTGAGCAATCTTGCGGGATCCCTTTAGCTGAGGGTGTGAGTGCAGCGTAATCTGT
AGTACCTTGATCATGGATGAAGCAGGTTTGCAGATCTGTGCCACGAAGGACACGGTACTG
TACTTCTACTATTTGAAATGGACTTCTCTCTTTACCTGGGCCTCCAAAGCAGGACCAGAG
ATGTGACACTATATAATCAGGAGAGTTAGGACCTCGGGTATGGTAGCTTCCCTCAGCTTG
CAACAGCAGCTGCTGGACACTTCAGGCCCTATAACTCATGCCCCTGGCTCCTGTGCCTGT
AATCCCAGAGCCTGAGCCCAGATTGTCTTGGCCAGCAGAGAAACCTCAATGTCTACTGGG
GATGGAGGTTGTTTTTTTGGAAACTTGCTATTCCCTGAGATTCTGAGAATAATCAGCTGC
CTGAACACACCTTGTCTTGGGCAATTGGGTCATGGAGCCAGGATCATAAACCTTTCGGTT
TTCCCTGGTGCAGTCAGTGCTCATTTGTGCTGCTCGTGGGTAGCACAGTCCTCTGGTTTG
GCTAGTATGAGGTTGAGTCTTCAGTGGGTTTGAGGGCTGGTTGTATGTTCCCCAGAGCTG
ACTTCAGGACATTCAGAGGGCTTGCAAGGGTCAGGGCAATTAGGGAGAGGAAATTAGGGA
GAGGTCACTGGGGGTCATGTCTGACCCTGGGTGCATCTGGGCAAGGCCCCTGCTGGCTGC
GCAGACCTGCGAGACCACTGACACACAAATGAGATTGGGAGATGCAGGAGCGCAAGTGCC
AGGTTGGCTGTGTTTGCAGTGGGTCTCTTGCCCTTTCCAGCTGCAACACAGAAACTCTGT
GAGCTGTTGAGGAGGTGTCGTGATTATACTCATGACTGGGGACTCTCAGAACACCCCACA
CTGGCAGAGGATCCAGGACCCAAAGGCCTTTGTGAGTCTTACATCCTGGGGGCAGCATGC
ATCGCACAAGTGGTTTTTTTCTTTCCCTGGAAGTTGACATGGGTTTGCAGAGTGCCTGTG
GACCTTGTCACTCTGGCCCTGAGGTTGTTGTCCACCCATGGTGTTAGAGACTCAGACACC
CAACAAAGCAGTACCAGTACATGGATGCCAGAACTGTCCTGGCAAAGGTCAGTCGGCCCC
TGGCAGGGCCGACACATCCTTGGATACAGATGCATATAAACTGTCATTCAGATCATCCCA
GAATTCAGAATGCAAGCTGAGAACCCACAAGGCCCACTTAGGAGAAACTTGTATAACCAT
AGTCCCATCATGGGCAGACATATTGAGTGAAAGGAAGATTCAGGGATGAAAATTGAGGGG
CACGCTGTGGTTAAGGACACCACATCAGCCTAGTACGGCAGCTCGGAGCAGGCCAGGGCT
CTGGTTTTCTCAAGCGTGCCTGTGGTTTGTGTGTACTTCTCAGGACTGCTTGCTGATGTC
AACGTGGCCGTGCAGGGTGGCAAGAAGTGTGCTTCTGCTGAGGACTTGAGGCCCTACAAG
ATGCTAGAATTCAAACTGCTCTTGGTGAGCGGGAAGTTCCTGGATCTCTGAGGACGGTAA
GCATGGCCAAGGTCAACCCTGGGGACAAAGGCATAGCACTTGACAGCCCCACAGACACCT
GAATGCTTGCTGGAGCCTTAGGCCATGCCTGGGCCACACCTCTGCATTGGACCACCTGTC
CTCCTTGTGCTGCGGTGTGTCCCTGGACTCTGCGGGGCTGCAGAGGTGGTTGGTGGATCA
GCTGACGAAGCACCAGGCCTTTAGTGTTGAGGACCCCACCCATTGGCATGTGCTTGGATC
GATGATGACTCCCCCATAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCAC
AACCGTCGTTCTCATCGTGACTGAGGTCCAGCACATTGCCTCTGGCAGGGACTATGGCAG
TAATAGCCCACATCCAGGGTAGCGGTTCTGCCAAACCCATGGGGTTTTTGTGGGTGGGAG
GATGTTTTTCGAGGCATTCGCTGTACCCTGGGGTTCTGTGACTAATCTGTTGCCTGAACG
CACCCTGTCTTGGGGTATTGGGTCATGTGGCAGCAACATAATCCTGGTGGTTTTCCCTGG
TCCAGTCGCTGCTCATTTGTGCCGATACTGGAATGCGCAGACCTTTGGTTTAGCAGGTGT
GAGGTTTATCTCAGTGGGTTTGAGTGCCGGTTGTATGTTCCCCTGTGCTGACTTCAGGAC
ATTCGGAGGGCTTGCCAGGGTCGTGGTGAATAGGGAGAGGCAATTACGTAGAGGTCACTG
GGGGTCAAGTCTGACCCTGGTTGCTTCTGGGCAAAGCCACTGCTAGCCCCCTAGACCTGC
GAGACCACAACACACAAATGAGATTGGGAGATGCAGGAGCGGAAGTTCTCGGTTGGCTGT
GTTTGCAGTGGGTCTCCAGCCCTTTCTGGCCACAACAGAGAACCCATGGGCAGTTGTTGA
GGAGGTGTAGTGTTCGTACTCATGACTGGGGACTGTGCAGGGCACCCCACACCTGGCAGA
GTTTCTAGCCGTGGAAATGCATGACTCTATCTCAGGTCCTGGGGGACAGCATGCATCACA
CAAGCGGTCCTTTCTTCCCTGGAAGTTGCCACAGGTTTTTGGGGTGCCTGTGGTCCATGT
CAGTGTGGTCCAGATGTCAGTGCCTACCCATGGTATTGAAGGCTGAGACCCCGAGCAAAC
AGTGCCTGCTGGTAGATGCAAAAACTGTCCTGTTAAAGATCACTAGTGGCAGGACCAACA
CGCACTTGTGACACAAATGCACATATACCGTGACTCACATCTTCCCTGAATTCCAAACTC
AAGCTTAGAATTCACAAGAGCCTACTCACGAGAAACTTGTGTATGCATAGTCCTATCATG
CAGATTGGCTCGAGTGAAAGGAAGCTCAGGGATAGATTAAGGGGATGTGCTATGGTGCGT
GACACCACAACAGACTAGCGTGGCAGCTCGGAGCCAGCCAGGGCTCTGGTTTTCTCAAGC
GTGCCTGTGGTTTGTGTGTACATCTCAGGACTGGTCGCTGATACGACGTGGCCGTGCAGG
GTGGGAAGAATATGCTTCTGCTGAGGACTTGAGAACCTAGAGGACGCTAGAATTCAAACG
GCCTTTGGTGAGCGGGAAGCTCCTGGATCTCTGAGGATGGTAAGCATGGCCCAGGCCAGC
ACTAGGCAAAAAGCCATATCACTTGACAGCCCCACAGACACCTGAATGCTCGTTGGATCC
TTTGGTCGTGCCACGGCCACACCTCTGCAGTGGTTGCCTTCCTCCCTGCACTGGGGCACA
TCCCTGGATTCTGTGCGGTGAAAAGATGGTTAGACTGAGCAGCTGACGAAGCACCAGGCC
TTCAGTGTTGAGGGCCCTACACCTTGGCATGTGCTTGGATCGATGATGACTGCCCCATAA
AGATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCATCATG
ACTGAGGTCCAGCACATTGCCTCTGGCAGGGACTATGGCAGTGAGGGCCCACGTCCAGAT
AGCGGTTCTCTCTACAACCCCAGGGGTGCCCATGGTGAATGGTCCATTCGAGCAGCCCCA
GGGGGACGATCCCTCAGCTGTCTGCTCAAAGCAGAAGATTGCCTGGTGCAGTGGGGCTGG
GAGTTTGCGTGGCGGCTCCCATCCTGGGCAGCAGTGGTGAGGATGCAGCAGGGTGTGCAG
GATCCAATTGTGTGGATGCAGGCGGAGCCAAGTATTCACCTCAGGGGTCTGCTGGGTGTG
GCCAAGGCCCTGGTTGTCTGTGCAGTGGTTCTCTGAACGGAGTGCTCCTCTTCCTGGCCA
ACAGCAGACACAAAGTATGATTGCCTGGCTAGCATTAGGTCTGTCAGCTGGTAGTCTGAT
GTGGCAGCAGAGTGCTGGAGGGCTATGAAGAGATCGGACAACCCCTTGAGTGTGGCATTG
ACACTTGGCAGTAGTGCCTGTGTGAGCTGGTGGTAGGAGTCAACCTGGCATGAATGTTGT
GTTCCCTTCTCTTGGGAGAGTCTTCCACAGAGTAGAGTGTCTCTTGGGCTGGGTGCAAAG
GAAATGACAGGGACAATGGGATGGGTTGTCTCTGAGGACACCCTGGTGAGCATGGTTGCT
GTGATTTCCTTTTTTTTTTTTTTTTTTGCTGTGATTTCTTGATGTGTGGCACCAGGTTCT
CTGTGGAATACTCAGGATTATCCTTGGTGATGTCAGAGATAGATCCTGCAGTGGAGCTTG
GCACACATCTGGTGCATTTAGGTTGGTGCCTTGGTTTGAAGGATTCCAGGCAAGTAATGT
GCCAGGATCACTTTGCTGAGGGTGTGAGTGCCACGAAATCTTTTGTACTCTTGAACTTGA
ATGAAGAATGTTTGCAGGACTCTGCTACAAAGGCTTGGGTACTGTGCTGATCCTTTTGAA
ATGGACATCTCCCTTTACCTGTGCTTCCAATGCAGGAACAGTGAAGTGACACAGTTAACT
CAGGAGAGTTAGGACCTTGGGCATGGTGGCTTCCCTCAGCTTGCAGCAGCAGCTGCTGGA
CTCCTCAGGCCCTGTAACTCATGCCCCTGGCTCCTGTGCCTGTAATCCTGGAGCCCGAGC
CCAGATTGTCTTGGCCAGCAGAGATAGCTCGATGTCTTGTGGATGGGAGGATATTTTTAG
AGGCATTTGCTGTACCCTGAGGTTCTGAGACTAATCTGCTCCCTGACTGCACCCTGACTT
GGGGGATTGGGTCATGTGGCAGGGACATAATCCTGGTGGGTTTCCCTGCTCTGGTGGGTA
CTCCCTTGTGCTAGATGTGGGTATTGAAGTCCTCTGGGTTGGCAGGTGTCAGGTTGAATC
TTCAATGGGTTTGTGGCCCGGTAGCCTGTTCCACTGAGCTGACTTCAGGACATTCGGAGG
ACTTGGCAGGGTTGGGGCTATTAGGGAGAGGCAATTAGGGAGAGGTCACTGGGGGTCAAG
TTTGACCCTGGGTGCATCGGGGCAAAGCCCCTGCTGGCTGCCCAGGCCTGGGAGACCACT
GACACACAAATGAGATTGGAAGATGCAGGAGCGGAAGTTCTAGGTTGGCTGTGTTTGCAG
TGAGTTTCTTGCTCTTTGCTGCCGCAACACAGAAACCGGAGCAGCTGTGGAGGAGCTCCT
GTGATCATACTCACTCCTGGTGACTCTCAGAGCACCCCACACCTGGCAGAGGTTCTAGGC
GACCAAAGGCCAGACTGTGTCTCAGGTCCTATGAGGCAGTGTGCCTCACAAAGTGGTCCT
TTCTTTCCCTGGAAGTTGCCACGGGTTTTGGGGTGCGCGTGGAAATTTTCACTCTGTGCC
AAATGTCAGTGCCCATCCACGGTATTAAAGGCTCAGACCCCCAGCAAAGCAGTGCCGGCA
GGTAGATGTCAAACCTGTCCAGAAAATGGTCACCGACGGCAGGACCAACACATACTAGGG
ACACGGACACATATATACTGTCACTCACATCTTCCCAGAATTTAGAACTCAAGCTGATAA
CCCACAAAGGCCTACTCAGGAGAAACTTGTGTGCCCATAGTCCCATCATGGACAGACTGG
CTTGTGTGTAAGGAAGCTTCAGGGATGAAGATTGAGGGGGGGCACGATGGCACGGGTCAC
CACGGGCAGCCTAACCGTGGCTCGGCCGGGGCTCTCGTTTTATCAAGTGTCCCTGTGGTT
TTGTGTGTACTTCTCAGGACCACTTGCTGATGTCAACGTGGCCGTGCAGGGTGGGATAAG
TGTGTTTCTGCTGAGGACTTGAGGCCCTACATGATGCTAGAGTTCAAACTACCCTTGGTG
AGTGGGAAGCTCCTGGATCTCTGATGATGGTAAGCATTTCCAGGGCCAACCCTGGAGACA
AAGCCCTTAATACCTCACAGCCCACAGAGAGCTGTATGCTCACTGTGCATTTGACCACGG
TTGGGCCATACCTCTGCAGTGGACCGCCTGTCCTCCTTGCATTGGGGGGTATCCCTGGAC
TCTGCAGGGCTGGGAAGGTGGTTGGACTGAGCAGCTGACGAAGCGCCAGGCTTTGTATGT
TGAAGGTCTCGCACCTTGGCATGTGCTTGGATCAATGATGACTCCCCCATAAACATTCCT
TGGAAAAGCTGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCATCGTGACTGAGGT
CCAGCACATTGCCTCTGGCAGGGACTATAGCAGTGAGGGCCCACGTCCAGGGTAGCAGTT
CCCTCCACAACCCAGGGGGTGCCCATGGTGAAAGATCCATTTGAGCGGTGCCAGCAAGGC
GATCTCTCAGTTGGTAGCTCTGGGCAGCAGAGTGCCTGGTGCAGTGATGCTGAGAGTTTT
CATGGCAGTTCCCCACGTGGGCAGCAGTGGTGAAGGATGCAGCAGGGTGTGCAAGGTCTG
ATTGTGTGGATGTGCCCAGGCCAAGTGTTTACCTCAAGGGTCTGTTGGGTGCAGCTAAGG
CCCTGGTTGCCTGTACAATGCATCTTGTTACCGAGTACTCCTCCTCTTGGCCAACAGGAA
ACATGAAGCCCGGTCCTCTGGCCAGCATTAGGTCTCTCTGCTTGTGTTCTGAAGTGGTAG
TAGTCTGCTGCAGGGCTCTGAAGAGATCAGACATCCCCTTGAGTGTGGCATTGACACTTG
GCGGTAGTGCCTGTGTGACCCGGTGGTAGGAATCAACCGGGCATGATTATTTGTTCCCTT
CTCTTGGGGGTGTCTTCCATAGATTGGGCAGCTCTTGGGCTTGTGTCAAAGGAATTGAAA
GGGAAAATGGGATAGGTTGTCTCCAAGGAAACCCTGGTGAGCATGGTTGCTGTGAGTTCT
CAAGGCAGGGCAGAAGGGTATTCTTTGGAGTTCGCAGAATGAACCGCAGTAATGTCATAT
TTTGACTAAACAGTAGAGCTTGTGCACACGTCTTGTGCATTTGTGAAGGTTACTTGGTGA
GAGGGATAATAGGCGAGCAATCTTCCGGGATCCCTTTGCTGAGGGTGTTTGTGCAGCATA
ATCTGTAGTACTCTTGATCATGGATGAAGCAGGTTTGCAATTCAGTTTCTCGAAGGACAC
GGTACTCTACTTCTATTTGAAATGGACTTCTCTCTTTGCCGGAGACTCCAATACAGTACC
AGTGATGTGACAGTGTATAATCTGGAGAGTTTGGACCCCTGGCGTGGTGGCTCCTCTCAG
CTTGCAACAGCAGCTGCTGGACACTTCAGGGCCTATAATTTTTTTTTCTGGTTCCTGTGC
CTGTAATCCCAGAGCCTGAGCCCAGATAGTCTTGGCGAGCAGAGAAACCTCTATGTCTGC
TGAGGTTAGAGGTTGTTTTTCCCGGGCTTTTGCTGTACCCTGGGGTTCTGAGACTAATCT
GCTCCCTAACACACCTTTTCTTTGGGGGTTTGGTAATGGGGCCAGGGACATAAACCTGTC
AGATTTCCCTGGTCTGGTAGGTGCTCACTAGTTCTGGTCATGGGTAGTACAGTCCTCTGT
GTTGGCAGGTGTGAGGTTGAATCTTCGGTGGGTTTGAGGGCCGGTTGCATGTTCCCCTGA
GCTGATTTCAGACATTTGGAGGGCTTGTCAGGGATGGGGCGATAAAGGACAGGCAATTAG
CGAGAGGTCACTGGGGGTCAAGTCTGACCCTGGGTGCATCTAGGCAAAGCCACTGCTGGC
CTCCCAGACCTGCGTGACCACTGACACACAAATGAGATTGGGAGATTTAAGAGCACAAGT
GCGAGGTTGGCTGTGTTTGCAGTGGTGCTCTTGTTGTTTCCGGCCAGAACACAGAAAGCT
TGGGCAGCTATTGAGGATGTCCCCTGATCATATTCATGACTGAGGACTGTGCAGGGTACC
CCACACCTGGCAGAGGTTCTAGGCGACCAAAGGCCTGACTGTGTCTCAGGTCCTATGAGG
TAGTATGCCTTGCAAAGTGGTGTTTTCTTTCCCTGGAATCTGCCACAAGTCTGTGGAGTT
CCTGTGGACCTTGTCACTCTGGCCAGATGTCGGTGCCCATCATGATATTGAAGGCTCAGA
CACCAGCAAAGCAGTGCCGGCAGGTAGATGCCAAAAATGTTCAGGCAAAGGTCATCGATG
GCAGGACCAATACACACTAGGGACATGGACACTTATGTACCATAACTCGCAACTTCCCAG
AATTCAGAACTCAAGCTGAGAACCCACAATAGCACACTCAAGAGAAACTTGTATAACCAG
AGTTCATCATGGACAGACTGGCTTGTGTGAAAGGAAGGTTCAGAGATGAAGATTGAGTGA
ATGCATTGTGGCGCAGGGACCAGGGTCATCCTAAGCATTGCAGGTCAGAGCAGGCCATGG
CTCTGTTTTTCTCAAGCGTGCCTGTGGGTTTGTGTGTACTTCTCAGGACTGCTTGCTGAT
GTCAACGTGGCCGTGCAGGGTGGCAAGAAGTGTGCTTCTGCTGAGGACTTGAGGCCCTAC
AAGACGATAGAATTCAAACTGCCCTTGGTAAGCGGGAAGCTCCTGGATCTCTAAGGATGG
TAAGTGTCGCTCCCCGTCTTCGTGGAGGAATGACACAGGACCCTGCGCTGTTCTTTTGTC
TGCTCGGCCCTCCCCGGGTTTGCTGCTGGTTCTTCCCGGGTTGGCTACCGACCCTTCCAC
CTCCGTGGAAGGGCGGTTCCCCCTGCCACTTTCCCCACTTCCGCGGGGGAGCGGCACACC
GCTGGCCGGCTCTCTCGGGGGCTGCACAGGTGTTCCTTCAGATAGATGTTCCCTGATGCA
TGTTGTCTCTCTCCTCCTTTATAGTCCTCTTCCACCAATCCCAACTCTGCTACCCACACG
CCAAGTACGCTGCTCTCCTCCAATCAGGAGCAGGTCCTACAGTTTATTGGTTGAATTGGG
GGCAGCTGTGTAGAAGCTGTTTCTCCCTTCCCAGCGCCATATTGTGGGAGAGCAGATGCA
GAGAATAAGTCTTAATTCCAGTAACTTAGTCTAGTCCGAGTTGCTCCCAGTTGCTCCCCA
CAGTAAGCATTTCCAGGGCCAACCCTGGGGACAAAGACCATAGCACTTCACAGGACAGCA
GGCTTTTGCATGCTAGCTGGATCCCTTGGCCGCACCTGGGCAACACGTCTGGAGTGTTCT
GCCTGTCCTACTTGCACTGTGGCATGTCCCTGGACACTGTGGGCCTGGGAAGGTGGTCAG
GCAGAGCAGCTGATGAAGCACCAGGCCTTTGGTGTTGAGGACCCCACCCATTGGCATGTG
CTTGGATCAATGATGACTCCCCCATAAACATTCCTTGGAAAAGCTTAACAAAATGAGTGA
GAACTCACAACCGTCGTTCTCATCGTGACTTAGGTCCAGCACATTGCCTCTGGCAGGGAC
CATGGCAGTAATGGCCCACTACCAGGGTAATGGTTCTGTCAAACCCATGGAGTGCTCATG
GTGAAAGGTCCATTAGAGCAGCCCCAGGGGGACGATCCCTCAGTTGTCTGCTCTGGGCAG
AAGATTGCCTTGTTCATTGGTGAAGTGAGTTTGTGTGGCAGGTCCCCACGTGGGCAGCAG
CGTTGAAGGATGCAACAGGGTGTGCAGGTTCGGATTGTGTGGATGAACCCAGGCCATGTA
TTCAACTCGAGGGTCTGCTGGGTGTGGTCGAGGCCCTGGTTGTCTGTGGAGTGGGTCTCA
GAATCGGGTGGTCCTCTACCTGGCCAACAGGAGACACAAATCCTGGTCGCCTGGCTAGCA
TTAGGTCTCTCAGCTGGTGGTCTGATGTGGCAGCAGAGTGCCGCAGGGCTCTGAAGAGTC
AGACATCCCCTTGAGTGTGGCATTGACACTTGGCAGTAGTGCCTGTGTGACCTGGTGGTA
GGAGTCAACCTGGCATGACTGTTCTTTTCCCTTCTCTTGGGAGAGCCTTCCACAGAGTAG
AGTGGCTCTTGGGCTGGGTGCAAAGGAAATGACAGGGACAATGGGATGGGTTGTCTCTGA
GGAAACCCTGGTGAGCATGGTTGCTGTGAGTTCTCGTGGCCAGGCAGAAGGTTAATCCTT
GGAGCTCCCTGGGTGATTCCCAGTGATGTTACAGTTTGATTATGCAGTAGAGTTTGGGCA
CACGACTGGTACAATTTTGTTGGTGCCTTGGTGGGATTCTAGGCAAGTAATGCGTCAGAA
TCCCTTTGCTGAGGGTGTGAGTGCCACGTAATCTGTTGTACTCTTGCCCATGGATGAAGC
AGGTTTGCTGGACTGTGCCACAAAGGTCTGGGTACTGTGCTTCTCCTATTTGAAATGGAC
GAAACCCCCTTTACCTGGACTTCAGAGGCAGGACCAGTGATGTGACGCAGTTATTTCAGA
AGAGTTAGGACCTTGGACATGGTGGCTTCTCTCAGCTTGCAACAGCAGGTGCTAACACTT
CAGGGCCTATAACTCATGCCCCTGGCTCCTGTGCCTGCAGTCCTGGAGCCTGAGCCAAGA
TTGTCCTGGCCAGTAGGGAAACCTTGATTTCTAATGTGGTTGAAAGTTGTTTTTCCGGAA
ACTTGCAGTACCCTGGGGTTCTGAGTCTATTCTGCTGCCTGAACGCACCCTGTCTTGGGG
GATTGGGTCATGGAGCCAGGGACATAAACCTTTTAGTTTTCCCTGGTCTTCTGGTGCTCA
CTTGTCTGGTTGAGAGTAGAGCCGTACTCCTGGTTGGCAGGTGTGAGGTTGAATCTTCGG
TGGGTTTGTGGCCCGGTTGCATGTTCTCCTGAGCTGACTTCAGGACATTCAGAGGTCTAG
CCAGGGTCAGGGCAATGAGGGAGAGGTGACTGGGGGTCCATTTTCACCCTGGGTGCATCT
GGGCAAAGCCCCTGTTGGCCACCTGGACCTGTGAGGCCACTGGCACACAAATGAGATTGC
GAGATGCAGAGGTGCAAGTGCTAGGTTGGCTGTGTTTGCAGTGAGTGTCTTGCTCTTTCC
GGCCACACAAAGAACCCCTGGGCTGCTGTTGAGGAAGTTCCCTGAGCCTACTCACGACTT
GGGACTGTGCAGGGTACCCCACACCTGGCAGAGGTTCCAGGTGACCAAAGACATGACTGA
GTCTGAGGTCTTGGGGGGCAGCATGCATCACACAAGCGTTGCTTTCTTTCCCTGGAAGTA
TCTGCGAGTTTTTCGAGATGCCCATGGAACTTGTCACTCTGGGCAAGATGTCAGTGTGCA
TCCACGGTATTAAAGGCTCAGACCCCCAGCTAAGTAGTGCCTGCCAGTATATGCAAAAAC
TGTCCTGGCAAATGTCACTGGTGGCAGGACCAACACACACTTGGGACACAGATGCACATA
TAGCATCTCACGCATCTTCCCAGAATGTAGAACTCCAGCTGAGAACCCACTAGGGCCTAT
TCAGGAGAAGCTTGTGTAGGCCTTGTCAATCATGGACAGACAGGTTCAATGAAGGAAGCC
TCAGGGATGAAGATTGATGGGATGTGCTCTGGTGCTTGACACCACAGCAGCCTAGCGTGG
CAGCTCGGAACAGGCCAGAGATCTGGTTTCCTCAAGCGTGCTTGTGCTTTGTGTATACGT
CACAGGACCGGTCGCTGATGTCGACGTGGCCGTGCAGGGTGGGAAGAAGTGTACTTCTGC
TGAGAACTTGAGGCCCTACAAGACACTAGAATTCAAACTGCCCTTGTTGAGTAGCAAGTT
CCTGGATCTCTGAGAAAGGTAAGCATGGCCAAGGTCAACCCTGGGGACAAAGGTCATAGC
TCTTAACAGCCCCGCAGATACCTGTATGCTTGCTGGAGACTTTGGCCACACCTGGGCCAC
ACCTCTGCAGTGCACCCTCTGTTCTCCTGTGCTGAGGTGTATACCTGGACTCTGGAGGGC
TGCAGAGGTGGTTGGGCGGAGCCGCTGATGAAGCACCAGGCCTTTTGGTGTTGAGGATCC
CACCCATTGGCATGTGCTTGGATCAATGATGACTCCCCCATAAACATTCCTTGGAAAAGC
TGAACAAAATGAGTGAGAACTCACAACCGTCGTTCTCATCGTGACTTAGGTCCAGCACAT
TGCCTCTAGCAGGGACTATGGCAGTGAGGGCCCACGTCCAGGGTAGCGGTTCTCTCCACA
ACCCAGGGTGTGGCAATCCCTCAGTTGTCCAATCTGGGCAGCAGAGTGCCTTGCGCAATG
GTGCTATGAGTTTGCGTGGCGGCTCCCCACGTGGGCAGCAGTGGCGAAGGATGTAGCAGG
GTGTACAGGGTCTGATTGTGCGGATGTGCCCAGGCCACTTATTTCCCACGAGAGTCTGCT
GCATGTGGCAAAGACCCTGGTCCCTGTGGGGTAGGTCTCAGAATCAAGTCTTCTCATCTT
TGCCAATTGGACCCACGAAGCTCGGTCCCCTGTCTAGGTTTAGGTCTAGGAGCTGGTGGT
CTGATGTGGCAGCAGAGTTCTGCAATGGTCTGAAGAGATCAGACATCCCCTTGAGTGTGG
CATTGACACTTGGCGGTAGTGCCTGTGTGACCTGGTCGTAGGAGTCAACCTGGCAAGAAT
GTTGTGTTCCCTTCTCTTGAGAGAGTCTGAGAGTGGAGCAGCTCTTAGGCTTGGTACAAA
TAAAATGACAAGGACAGAGGGATGGGTTTTCTCAAGGACACCCTGGAGAGCATGGTTGCT
ATAAGTTCTTGAGGTGCAGCAGCTTGTACTCCATGAATCACCCAGGGTGATCCCCAGTAA
TGTCATATTTTGATCATGCAGTGGAGCTTGGGCACACATAGGCTGCAGTTTTGAAGGTTC
CTTTGTGGGAGGGATAACAGGTGAGCAATCTTGCGGGATCCCTTTAGCTGAGGGTGTGAG
TGCAGCGTAATCTGTAGTACCTTGATCATGGATGAAGCAGGTTTGCAGATCTGTGCCACG
AAGGACACGGTACTGTACTTCTACTATTGAAATGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved