Oryctolagus_cuniculus Locus Mono:39:U3
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:39:U3
Oryctolagus_cuniculus
Mono:39:U3
scaffold_148253
U3
1001..1214
2214
ACCTAGTTTTGGGGGTAAGGGGTGGTATAAGAGAAAGTGTGAAACCTTTCAGAATCACT
GAGATATGTTATATTATTATTAAGAACAATATGGCACTTATTTATATATATTTTTTCTTT
TAAATACTAAGGCTAAAGGAAACAACTAAAGGGGCTGGTGTTGCAGGGCAGCAGGTTTGA
CCACCCTGTGTGAGGCCAGCATCCCATATGACCATCAGCTGAAGTTCAGGCTACTCTACT
TCCAATCCAGCTCGCTGTTGAGGTCCAGGAAAAGCAGGGAAGGATGGCCGAAGTGTTTGG
CCTCCTGCACCCTTGTGGGAGACCCAGATGGGGTTCTGGGCTCCTGGCTTAGGCCTGGCC
CAGCTCCAGTCTTTGTGAGCATTTGGGGAGCGAACTAGTGGATGGAAGATTGCTTTCTCA
GTCTCTTTCTCTCTCCTCTCTCTGTAACTCTGCCTTTCAAAAAAATAATAAGTCTTCATT
TAAAAACCAGCTAAAAATGAACTGTGATCTCTCTCTAGATAGAAAAATTGAAAACTATAA
GGCTGAAAACTGAAACAGTACAAGAATGTACAAAATCACTGTTAAAAGCACATCCCAGCG
AAGCATTTTTACAATACCCCGCCTATTAGCTTCAAAGCTCAGAATCTTCACTGTAAAGAA
GAAAAGCCACCCACCGAGGTCGCGGTCGGGTTTCAGATTAATTTGACGCTCGGGGCCACA
CCCTCCACCTTGAACTGTCGTTAGCGGCAGAGACAGTCGCTCCTGATTGGCTGTCGCGCC
TGTCAGATGCTAATCGGGCTCCTGCAGGTTTAGTTCTTTTTCCCATTTTTAATGTAGCGT
CGGAAGTGTTGGGAATGCGGTTTGGAAGCTGTCTCTGAAGCAGCCCTTCAGGAGTGCGTC
TGTGGAGACTTTGTAAAGGGAGATCAGCGCGGACACTGTCTCGCCATCGCTTACAAGTGC
GTGGCGTGCGCGGGCCCGGCGGAGGCGGCGGGGTGTGGGTCAAGACTATACTTTCAGGGA
TCATTTCTATAGTTCGCTACTAGAGAAGTTTCTCTGAACGTGTAGAGCACCGGAAACCAC
GAGGAGGAGGCGCAGCGTCGTCCCCTGAGCGTGAAGCCGGCTCTTGGTGCCGCCTCGCTG
CGGCCGCCATTTGCCATTGATGATCGTTCTCGTCTCCCTCCGGGGAGCGAGAGGGGGAGG
ACGCAGTCTGAGTGGTTCCCGTCTTTAAATCTGGTATCTAAGGAAAGTTTGGTGCTTGTT
TTCCATTTATATACTAGTACCACTATTTTAGGTTTAGTGGTGCTATGTAAGAACTTAAAC
GACTCCACTTTTCACAGGGTTGTTTGCTAATGTGTTTGGGGAATTAGTGCAAGAAGGCAC
AAGTCCACTCCTTGCAGCTGAGGTTGTTTTTTTTTTTTTTTAATTTCCTTATATGGTCAG
CGTTCCTTTCTGGGAATCATTATGCTGTGATTTTACTCCTTAGTATTTTGAGCAGGACTT
AGACAATGTAAATCTCTGTTTTTTTTTTTTTTTTTTTTTTGAGCAAAGACACATCCTTTA
TTCCAAGATAAATACAGAGCTCAATTAGTATTCCCCACCAACATCACAAGGGAGGGGGAC
TAGACAGCATTCAGGTGTGATGATGTCAAATCTAATGGGTACAGGAACTGCTAAGATCAA
GGTCTAGAATATTAGCCCTAGACTTAAGTGAGGGTTTATCACTCTTAACCTCTTCGAGGC
TGTGTCAGATTCCATAGCCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAGAACAAACTTGCAGGACTCCCACGTTCCAGTTTGG
AGACCTCTCACAAAACCACATTTTTTTTTTTTTTTTTTTTTTTTACCGGCAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved