Oryctolagus_cuniculus Locus Mono:15:SNORD77
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:15:SNORD77
Oryctolagus_cuniculus
Mono:15:SNORD77
scaffold_215462
SNORD77
1001..1068
2068
GCCTGCAAGCGGCTGACCCACGGGTCCCCAGTTCTTCATCTGCGCCTTGGGTGGGGCTG
GACTGGGACCACCAGGGCCCTTACACATCTAGGACATCATACTAGCCTTGTGGTATCATG
TCCAAGCCCATGAACATGGCTTTCTTCCAGATCAAAGTGAGCCTTGTCAGATCTTAGTGA
GATGGGAACGGAGTTAAGAATAGAGTATTAGTTATGCAGGGAATCTTGGCTGAATCACCA
TTTAGTCACTGGGATGTTGTTAAAATATTTGTACATCTCCAAGGCTAGATGTTGAAATTG
TTTCTTTGCCTACTTCTTTTGCTCTAGAACAGATCCAAAGAGCTAAAATTTACTATAAAG
GCATACCACTCTCATTACAGTAGGCATGGCACTGAAGTTGTCTGTAAATCCTTTTTTAAA
CACTGAGTTGTGTGTTCCTGGAACAAACATTGGTGGAGCTACTTACTATATGTCTGTTAT
ATACTAGGTGCATGAGATGCAAAGAGGAGGAACATGGCCCTTTTCCCAAGGTATGCCTTA
TTAATTCATTTCTTTTAAAAAAAGATTTATTAATTTATTTGAAAGTCAGAGTTACAAAGA
GAGAGGAGAGGTAGAGAGAGAGAGAGAGAGAAAGAGAGAGGTCTTCCATCCTCATGTTCA
CTCTCCCAATTGGCCGCAACAACCGTAGCTGCGCTGATCTGAAGCCAAGAGCCAGGAGCT
TCTTCTGGGTCTCCAACATGGGTGCAGGGGCCCAAGCACTTGGGCCATCTTCTACTGCTT
TCCCAGGCCACAGCAGAGAGCTGGATGGGATGTGGAGCAGCCAGGACTCGAACCGGTGTC
CATAAGGGATGCCGGCACTGCAGGTGGCAGCTTTACTCACTACGCCACAGCGCCAGCCCT
GATTAATTCATTTCTTTCTCTTTCAGTAATTTTTGTGCTGAGGCCTGTATTATATTCCCA
GATACTGTTCTAGTGCCATCTACTCTGTACACAAGCAGTTGATACTATGAAGGCTGCATT
GTTCAGCAGGTTGAATCATGAAAAGAGGCATCGTTTATTTCATGTATCTCAGGACAAGGA
AAACAAGCAGTTGTCATACAGTGTAGTCATGCTGTCACAGAGCCTTGTACGTGGTGCAGA
AATGGCAAGAAGGAGGCTTGGTGGACTTTCTGGGGAGTTCAGGGTGGGCTTGGCAGAGGA
GTTGCTATATGAGCCAGGTCTTGAGTGCAAAGTAGTAGCTGGACAGCTTGACGAGGTTAG
CAAGAGCTTTCTGGGTAGGGGGCAGTGCTTTGGTAACACCATACATTAGCATGGCACACC
AAGGGAACAGGTAGCTGCAGGTGTCTTGATGCATAGGATGTAAATTTAGTGGCGGGGTCC
ACTGAGACAGGACAGCAAGAGATTCCGCTGGACAGCCTCAAAGTAGCCACACGTGGAGAC
GTATGGATGTGGCCACGGCAGGTAGTTGTGTTCAAAAAGTTAACATGGACAGACTTACAA
TCTGGGGGGAAAAACTTGGAAAATATCTTGAATGGGGGAAGGCAAGAGGCAACAATATGA
ATCCAAGGAAGAAAAGAGTGACAGCTGGTCTCCAACCGTAGGAGGAAATAGTGTGTAACA
CATAAAAGGAAAGGGAGAGTGGCTCAGGCTGACGCTCAACTAAATAGGAAAGGAAATGTC
TCAAGGCAGCCTGGGGCAGCACAGAGGCGCCGTCTGCCTTCATCATGGGGCGTAGACAGA
GCTCCAAGCAACAGGAGACAAAACTGATGGAAACAAAGGGAACAGAGAATTCACCCTACT
GTAGGAGCCCGGAATAATTCAGAGACCTGGTTGATCAGGCAAACAATAAATAAGGACAAA
GGCAAATCTGAAGAGCACGACACATAGGCCAGGCCTGCTGTCCAATTATGAGCCCAACAA
GGATGCAAATCCTTTCCAAAATGGGATTGTTGTCAGTGAAGATCCCAGGCCCTAAGCCAC
CAAATCGGGTCTCCGTGTATTACCGTGAGGAGAAATGGTATCATCAAAGCGCTGCGTTTG
GGTTCAGACCACCACTGCACCTGGCCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved