Oryctolagus_cuniculus Locus Mono:137:SNORA73
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:137:SNORA73
Oryctolagus_cuniculus
Mono:137:SNORA73
scaffold_115276
SNORA73
1001..1203
2203
GAGCAGCCAGAACTCAAACTGGTGCCCATATGGGATGCCAGCACTGCAGGTAGTGGCTT
AACCCACTACGTGACAGCACTGGCCCTTAGACTGAAATTATACCACTATAAATGCATGTT
TTGGAAAAGAAGAAGATATAAAATTAATAATCTAAGCTTCCACCTTAGGGTACTAGGGGA
AAAAAAGAGAAAATTTTATTAAAATTAAGCAGAAGAAGATAACTTATAAAAATGTGGGCA
GCAAACATCGAAATTGAACAGAGGATATCAATAGAAAAAGAATCAATGAAACTAAAGCTG
GTTCTTTGCAAATATCAGTGCAATTATAAACATCTAGTTAGGCTCACCAAGAATAAGAGA
CGCTACACATTACTAATAGCAGAAATGAAGGAAGGATATCACTCTTGATCCCATGAACAT
GAAAAGGGTAATAAAGGACTATTAGGCTGGCGCCGCGGCTCACTAGGCTAATCCTCCGCC
TAGCGGCGCCGGCACACCGGGTTCTAGTCCCGGTCGGGGCGCTGGATTCTGTCCCGGTTG
CCCCTCTTCCAGGCCAGCCCTCTGCTGTGGCCAGGGAGTGCAGTGGAGGATGGCCCAGGT
GCTTGGGCCCTGCACCCCATGGGAGACCAGGAAAAGCACCTGGCTCCTGGCTCCTGCCAT
CGGATCAGCGCGGTGCGCCGGCCGCAGCGCGCCGGCCGCAGCGCGCCGGCCGCAGCGGCC
ATTGGAGGGTGAACCAACGGCAAAAAGGAAGACCTTTCTCTCTGTCTCTCTCACTGTCCA
CTCTGCCTGTCAAGAAAAAAAAAAAAAAAAAAAGGACTATTACAAATAATTATAATCAAT
AAATTTGATAACTTAGATGAAATAGGCTGATTCCTTAAAAAGATACAGTCTGCCAAAAGA
AACAGGAAATCTGGGTAATCTGAACAGACATCTATTAAAGAAACTGAATAAATAATAATC
TTCTGAAGCAGAATGCACCAGACCTAGAATTCACTTATGTTCCAACGTGGACACCCTGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCACAGGGCTCTGCCCGATG
ATGTACAGTCCCTTCCCACGCTGTTGGAGAAGAAGCGGGCCTCAAGTCTGTGCCTGCATA
TTCCTACAGCTTCCCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAAAC
AGTCTAAGCATGAAAAAAAAAAAAAAAAAAAAAGAATTCACTTATGAATTCTACTAAAGT
TTAAGGAAGAAAGTATACCATTATCTCTATAGTCTCTTCCAGAAAACAGAAGGAAAAAAG
AGAAAGAACATTTCTTCGTTGAGGCCAGAATTATCCTAATATTAAAGCCAAAGATATAAA
AAAAGCAAAAACAAAACAAACAAACAAACAAAACAATACAAACTGATATCTCTCTTGAAC
ATAGGTGTAAAATTTCCCAACAAAATATTAGCAACTCAAATCCAACAATGAAAAAACAAT
TATACATTATGGTTATTTTTGCCCATGTTATATTGCTATAACAGAATACCACAAAGTGGA
TACTTTGTAAACAATAGAAGTTTATTCATTTCATGGCATTATTAAGGTGCTTGCATCTGG
TGAGGGCCTTCTTGCTGTATGGCATATGGCATATGGCAGAGGGCACTTAACGGCAGGAGA
TTGCAAAAGTATACAGAAAAAGACAGAGAAACCTTTCCTACACTGGGTTACTCTCGACAC
TCATGACAGCAGAGTGGGACTGGGCCAGGTTGAAACCAGGAGCTTAGAACTCATTCCAGA
ACTCCCACATAGGTGTCAGGAACCCAAATACTCGACCCATCATCTGCTACCTCCTGCCTG
TTAGCAGGAAGCTGGGAGCAGAAGCACAGCTGGACTCTGCTGTGGGATGCAGGAGTCCTA
GGTGGAGCCTTAACCATCACACCAAACGCCCACCCCAGGATACACAGTGTTTTAATGTGG
AAGTCATCATCATAACAATTTTTTTTCACTTGTTGGTTTCTTGCAATAATGAAATAGTGG
GATCAAAATTAGAGAATGGATTAATTGTGTCATTTTTATACAATGAAAAACCAAACAGCA
GCTACAATATATCAGAGTTGTTGTGATCTACATGAATTAATATGGATAAACCTCAAATAT
ATATATCCATATTTAATATTTTCTAATATGTTCATGGAAAATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved