Oryctolagus_cuniculus Locus Mono:10:SNORD20
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:10:SNORD20
Oryctolagus_cuniculus
Mono:10:SNORD20
scaffold_204387
SNORD20
1001..1079
1557
CAACGGCAAAAGGAAGACCTTTCTCTCTCTCTCTCTCTCTGTCCACTCTGCCTGTCAAA
AAAAAAAAAAAAAAAGGAGCATAGGCCAATATTATTTTACTTTGTTTAAAAGGCAGAGCT
CTTTAGTCTGCTTCATCCCCCAAATGCCCACAACAGCCAGGAGCCAGGGAATCCATCCGG
GTCTCCCATGTGGATAGCAGGGGCCCATGGACTTGTGCCAAACACTGCTGCCGTTAATCA
GCTCACGCAGCGTCCAGAGTGCTGCCTTAGCCGTCGAGCCACACTCCTGTCCCCGCAGCT
GTTCCGGGAAGACACCAGTAGTCAGCTTCCACGTGTGAGAAAGGACAGAGTGCCCGGTGC
TTGCACGTGGTGACTGGGCCGTGTGTTGAGGAAGGGAGGTGGGGCTTCCTCAACGTCAGT
AGGGCAACTTTTTCAGGTAAAAAATCTTAAGAACAAGAAAGTACACCTAGGAACCGCTGA
TTCAGAGTCTTAAGGGTGGCGTCTATTTGCAGGTGAATCAAAAACTCTGGTGTTGAGCAA
TCTCTCCTACAGTGCAACAGAAGAAACTCTGCAGGAAGTCTTTGAAAAGGCAACGTTCAT
CAAAGTGCCACAGAACCAAAATGGCAAATCTAAAGGGTAAGTGTTGTGTCTGTAGGGGTA
AAGGGCACAGCCACTCTCCTGGCAGAAGCCGAGGGGGTTGACAGCACACGCAGGTGGAAA
AGCATTTCCGTATCTGCTGGCGGGAAAAGGCCTGGCGTCACGTGAGCCTGGTAACGCTCT
GTATTGATGGTTGATTCCCAGGTATGCGTTTATAGAGTTTGCCTCATTTGAAGATGCGAA
AGAAGCTTTAAATTCCTGCAATAAAAGGGAAATTGAGGGCAGAGCCATCCGGCTGGAGTT
ACAGGCACCCAGAGGGTCACCCAACGCAAGAAACCGTAAGTTCCTGTGGGCGGGATGTGG
TGGCTGGGGCGGACGCTCTGTTGTGCTGAGTGAATGGCAGCTGGATATGATGACAGACGG
CCTGAGAAGGAATGATGAAATCTCGAGAGAATTCCTCTAGATAGTCAAGTTCTGATCTGG
CTGTCAGCTCAGCGGCGGCTTTGGCAGTGGCGGATCTTACTGCAGCCGATGGCTGGAGTT
GGCAGTTCACTGGGTCGCTCTGCTCCAGCGTGGAGACGTCATGTGGGAACTTGATATCAC
AGGCAAGCTTTCTTCCCCCCAGAGCCAACCAAGACCTTGTTTGTCAAGGGTTTGTCTGAG
GAGACCACCGAGGAGACGTTAAAGGAATCATTCGACGGCTCTGTCCGGGCGAGGATAGTG
ACGGACCGGGAGACGGGATCCTCCAAAGGGTAAGGTGCAGGGAGCGTGCGTGCAGTGCGG
CTTCCGCTCGGCTGCGCTCCTGGGCGGAGCGGGGCTAAACCAAGTCTTCTCACTGAGCTC
CTTTCTGTCAATTGGTGGCAGCTTACGGATTCGCAAGAGAAGAAGAGACAATTCACAGAA
CTAGCATTATCTTACCTTCTGTCTTTACAGAGGTATGTTTGCTGTTTTGTGAGACATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved