Oryctolagus_cuniculus Locus Mono:13:SNORA25
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:13:SNORA25
Oryctolagus_cuniculus
Mono:13:SNORA25
scaffold_211554
SNORA25
1001..1120
2120
GTCTAACTCTGCATGTCAAAAAAAAAGAGTTTGTCATTATATTAACAATCATTGAATTT
ATATTTTTACCATTCCCTGAACTGAGGCCTTAATTGAGCCACAGATAGCTGCTGTACTGT
GTGTGCTCGCCTCTGAAGGGAAGTGCTCTATGCAATCCCGTACTTCTTCCTAGGACAGCT
TGTCACAGAATCAGTAATTGTGATCAACTTTCCTTGTGTGTGAACATTAAATATAAGGCA
AAGTCCTCATGAAATCACTTTAAAAATATGGTGAGCAATAAAAATCTATTGCCTATTATA
ACCTATTTCTTACTAGAATAGCCAAAGTTAATCCTCCTTGTCTCAAAATGATTTCAATTT
TAACTAGGTTCGTTGAAGCATCTTTAGATCTTACACTGGAATGGTCATTAAATCAGATGA
CATCACATTTATAGTGCCACTGTTCTGCTGTCTAAAAACATAAGGAGAAATTAATTTAAA
AAGTTTAAAAATTTCATGCTAAATGTAGAAAATTTGGTTCCAATTTTGTAAAGAAACATT
ACAATGATTGATGTGTTTATCAACAGAGAAAAAAAAAATACAGGAGACAGAAAGTTTCCT
GGTGGCACCAAAAGATCTAAAATGAACACTTGTAAAAATTCCCCAGGGACAATAACAGTA
GACCATATTGGCTGCCATATTAGACAAACACTTCTGGGGAAACTTTTCTAGGATACCAAA
GAATTTGTTCAGTTAGTGCCTTTCTTAGGATCAAAAATATCTCATAAAAATTTTAAAGGC
AGAAGAGGGGCTTGACTACTGACCTAAGGAACTATTTGAGGATCTCCAAAAGGATTTCAC
ACAATTGCATTTTGTGTTTGGACTACAAAGGTGCACAGGTTATAGATTTTTGTTTTCTAC
ATATAGGTATTAAAATGATTACAGAAACAAATAAACATATCTAACATCTTGTGTCATTAC
TTTCGTGTGTCACAATACAAAAACAATTTTTAATAATCTTAAGTCATTTCAAAAAGGGCT
TGTAAGGATAGGAAACCAAGAGTTCTTAAAGCTGTGAACTAAAATGGAATTTCTCCTTAA
GATGCCACAGTAGTGCCATGTTTTCCTGAGGAGATACACGGATTTAGTCAAATTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCCAGGCCACAGCAGAGAGCTAGAGCAGAAATGGAGCCACCAAGACTTGAACCA
GCGCCCATATGGGATGACGGCAATGCAGGATGCGGCATTACCCCTAAGCCACAGTGCCAG
CACCATAGTTTTCTTAAAAAAAAACTAGAAGAAAGGATTTTGAATAATTTCACCAAGAGG
AAATAAATGTTTGAGGACATATCTATGATCATCCTTTTTTGAATATTACACAATGTGTAC
ATTTTGAAACAACACCCAGTACCACATAACTTTTTATAGTTTTGTGTGTCCATTAAAAAT
AAATATAAAACCATCTCAAGTAATAAAAAATTAATCTAGGCACAGTTAGCCAACAATATA
TTCTAAAGTTTTCTTTGTCATCTCGACCTCATCCTTTTTATTCTATGCTTTTAATGTCTG
TATGTTAGCTTCCATTTACAAACAAACAGTATAGCAAATACTACTATGCCAAAAGAAAGG
AGCTGAGGCTTCAGCTTCAGTCAAAGGTTTGAGTACAGGATGCAGGTGCCTGGGGAGCAG
TGTGTACTCGCTACACAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved