Oryctolagus_cuniculus Locus Mono:230:SNORD48
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:230:SNORD48
Oryctolagus_cuniculus
Mono:230:SNORD48
GeneScaffold_2805
SNORD48
1001..1063
2063
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGAG
GGAGGGGAGGAGAGGGGAGGGGAGGGGAGGGGAGCGGTAGAAGAAAAGGAAGGAAAGGAA
GGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAG
GAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGAAAGGAAGGA
AAGGAAGGAAGGAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG
AAAGGAAAGGAAAGGAAAGGAAAGGTAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG
AAAGGGAAAAGAAAGAAAAGGAAAGAGAAAAGAAAAGAAAGGCAACTACTAGCTTAAAGA
GATCATTTTTTTTTAACTAAGGTTACTAAGCAGAACCGAGAGCAGGACTCAGGTTTTGTA
ATTCCTGGTCCAACACTCTCTAGTAATAGGGAACACTGAGTTTTCAGTTCTCTGAAGTCA
ACAACAATGCTCTTTGGTGTAACTGCTTAGTGTGATTCTGCTGAAGAAGATTTAGAGTTG
AACTCTAGACTTCAGCCTTGGATAATTAAACAGCATTCTTCTTAAACAAAGAGATAGCTG
AATTCAGTGATAATTTTCTTAACCATTTTTACTTAGTCAAGCGAATTGTTACGGAAGCAA
TGCAGCACATTATAGCAACAATGCCCTTGAGCTCTAGTTCTGGTCTCAGAATCCTTACTA
TAAAATGAGGAGCCACACTTGTCTCTAAAATTTGGGGACAGGGTGAAGATAACTTTAGGT
GGCTCTGAGTGTCTCACTGACACCATCACTGCAGCATGCTGACCATAAAAAATAATAATA
ATAAAAATAAAAATTGGGAGACAAGGAGCCTGCCCATTAACTGTCAACCCAAACACATTT
CATGAATTCAGCAAAAAGAACAGTAATTTAGATCAGAAGTTCGGCTTTGTCATAAAATAA
CAACAAACAGAGTAACAATTTTCAAAATATTTCTAAAACTTATGCTTTGTACAGTGCATC
CATACCATCCATTAATCTGTTTGGATCTCTCTACTGGGAGAGTAGGCATTATTGGCATTT
TACAGATGAAGAGGTTAAACTAGGGAACAGGATATATGCCCCCAAATCACAGTTTTATGT
GTAGAACTCAAGCCTTTCACTGTGTGTCATCGCCACACTGCTCCCCGCTCCCTCTCTTTC
CGGAAGAACAGACAGCCCTGCCTATGCAAAGATGACTCTGGACATGCATGCAACCAGTTC
CCCAGGACCTAACAAGATGCCTGGCATTCAGCAAAATAACTGGCAGCAAAGAACTACCTA
GATATCTGGGACCAGTCTCTCCCTGGAGCCCTCATCCCTCAGCACTTCCCTTTGGGGGAA
ATTTTTCTGAGACATAGCTCCCTCCTCCCCCCACATGAGGAAGCTCAAGATGAAAAGCAG
ATCGAAACAAAGGCAATCAGAAAGAAAGAGGACTACAAGTTCCTGATTTGTAAGAGGACT
GCCTCTGAATCACTCTAATCAGGGTGTTTTCAAGTTTCCAGAAAAAGCTGAATTTATCCC
ACTTCAAATGCCTGCTCCTCCAAAGGCCATTCTTTTAGCACCCACATGATTGCTAAGCAA
CTTTGCTCTCATTCCTCTGATTTGAAGAATAAACTATTGTTACTACAATAAAAGATTCAT
GCTCCTGGCAGAAACTCATCTCTCCATGTGTTTGTCTGGTATTGCCCCTACAGGGCCTCT
GCTGACAAGAGATGACTAACTGCACAAGCCCTGCTCCTGTGGTCTATTCCTGTTCGGTGG
TTTGACATTTACCTTTTTTAAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved